Variant information

Chr11:37224475 - 37228037

Filter



 [SNPs] [Indels] [SSR-associated indels]

SNPs

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
37224488CT462221.771.00DOWNSTREAM(|3841||None|Vigan.11G249800.01), DOWNSTREAM(|4862||None|Vigan.11G249500.01), UPSTREAM(|772||None|Vigan.11G249600.01), UTR_5_PRIME(|39||None|Vigan.11G249700.01)Vigna nepalensis
37224503CA512266.771.00DOWNSTREAM(|3826||None|Vigan.11G249800.01), DOWNSTREAM(|4877||None|Vigan.11G249500.01), UPSTREAM(|787||None|Vigan.11G249600.01), UTR_5_PRIME(|24||None|Vigan.11G249700.01)Vigna nepalensis
37224513TG522446.771.00DOWNSTREAM(|3816||None|Vigan.11G249800.01), DOWNSTREAM(|4887||None|Vigan.11G249500.01), UPSTREAM(|797||None|Vigan.11G249600.01), UTR_5_PRIME(|14||None|Vigan.11G249700.01)Vigna nepalensis
37224574CT461819.771.00DOWNSTREAM(|3755||None|Vigan.11G249800.01), DOWNSTREAM(|4948||None|Vigan.11G249500.01), SYNONYMOUS_CODING(SILENT|ttC/ttT|F16|None|Vigan.11G249700.01), UPSTREAM(|858||None|Vigan.11G249600.01)Vigna nepalensis
37224618AT462071.771.00DOWNSTREAM(|3711||None|Vigan.11G249800.01), DOWNSTREAM(|4992||None|Vigan.11G249500.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|902||None|Vigan.11G249600.01)Vigna nepalensis
37224626AT472164.771.00DOWNSTREAM(|3703||None|Vigan.11G249800.01), DOWNSTREAM(|5000||None|Vigan.11G249500.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|910||None|Vigan.11G249600.01)Vigna nepalensis
37224627CA482164.771.00DOWNSTREAM(|3702||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|911||None|Vigan.11G249600.01)Vigna nepalensis
37224687TG602321.771.00DOWNSTREAM(|3642||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|971||None|Vigan.11G249600.01)Vigna nepalensis
37224699AG531831.771.00DOWNSTREAM(|3630||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|983||None|Vigan.11G249600.01)Vigna nepalensis
37224790GA532281.771.00DOWNSTREAM(|3539||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|1074||None|Vigan.11G249600.01)Vigna nepalensis
37224809GC462027.771.00DOWNSTREAM(|3520||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|1093||None|Vigan.11G249600.01)Vigna nepalensis
37224837TG552191.771.00DOWNSTREAM(|3492||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|1121||None|Vigan.11G249600.01)Vigna nepalensis
37224896GT512369.771.00DOWNSTREAM(|3433||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|1180||None|Vigan.11G249600.01)Vigna nepalensis
37224898GT512294.771.00DOWNSTREAM(|3431||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|1182||None|Vigan.11G249600.01)Vigna nepalensis
37224931TC582661.771.00DOWNSTREAM(|3398||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|1215||None|Vigan.11G249600.01)Vigna nepalensis
37224936CT602630.771.00DOWNSTREAM(|3393||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|1220||None|Vigan.11G249600.01)Vigna nepalensis
37225002AT662773.771.00DOWNSTREAM(|3327||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|1286||None|Vigan.11G249600.01)Vigna nepalensis
37225018TG632702.771.00DOWNSTREAM(|3311||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|1302||None|Vigan.11G249600.01)Vigna nepalensis
37225100TC542034.771.00DOWNSTREAM(|3229||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|1384||None|Vigan.11G249600.01)Vigna nepalensis
37225140GA451942.771.00DOWNSTREAM(|3189||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|1424||None|Vigan.11G249600.01)Vigna nepalensis
37225172AG462085.771.00DOWNSTREAM(|3157||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|1456||None|Vigan.11G249600.01)Vigna nepalensis
37225195GC472050.771.00DOWNSTREAM(|3134||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|1479||None|Vigan.11G249600.01)Vigna nepalensis
37225245GT411631.771.00DOWNSTREAM(|3084||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|1529||None|Vigan.11G249600.01)Vigna nepalensis
37225433CT642519.771.00DOWNSTREAM(|2896||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|1717||None|Vigan.11G249600.01)Vigna nepalensis
37225450TA612459.771.00DOWNSTREAM(|2879||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|1734||None|Vigan.11G249600.01)Vigna nepalensis
37225467CT723297.771.00DOWNSTREAM(|2862||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|1751||None|Vigan.11G249600.01)Vigna nepalensis
37225476GC713165.771.00DOWNSTREAM(|2853||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|1760||None|Vigan.11G249600.01)Vigna nepalensis
37225599GA732938.771.00DOWNSTREAM(|2730||None|Vigan.11G249800.01), NON_SYNONYMOUS_CODING(MISSENSE|Gta/Ata|V86I|None|Vigan.11G249700.01), UPSTREAM(|1883||None|Vigan.11G249600.01)Vigna nepalensis
37225632CT622885.771.00DOWNSTREAM(|2697||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), SPLICE_SITE_REGION(|||None|Vigan.11G249700.01), UPSTREAM(|1916||None|Vigan.11G249600.01)Vigna nepalensis
37225634GA642976.771.00DOWNSTREAM(|2695||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), SPLICE_SITE_REGION(|||None|Vigan.11G249700.01), UPSTREAM(|1918||None|Vigan.11G249600.01)Vigna nepalensis
37225645TG653076.771.00DOWNSTREAM(|2684||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|1929||None|Vigan.11G249600.01)Vigna nepalensis
37225649GT663121.771.00DOWNSTREAM(|2680||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|1933||None|Vigan.11G249600.01)Vigna nepalensis
37225671AG662960.771.00DOWNSTREAM(|2658||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|1955||None|Vigan.11G249600.01)Vigna nepalensis
37225673TG642914.771.00DOWNSTREAM(|2656||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|1957||None|Vigan.11G249600.01)Vigna nepalensis
37225726AT632763.771.00DOWNSTREAM(|2603||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|2010||None|Vigan.11G249600.01)Vigna nepalensis
37225744CG552416.771.00DOWNSTREAM(|2585||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|2028||None|Vigan.11G249600.01)Vigna nepalensis
37225745AT542416.771.00DOWNSTREAM(|2584||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|2029||None|Vigan.11G249600.01)Vigna nepalensis
37225860GA622468.771.00DOWNSTREAM(|2469||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|2144||None|Vigan.11G249600.01)Vigna nepalensis
37225875TC622424.771.00DOWNSTREAM(|2454||None|Vigan.11G249800.01), SYNONYMOUS_CODING(SILENT|gaT/gaC|D97|None|Vigan.11G249700.01), UPSTREAM(|2159||None|Vigan.11G249600.01)Vigna nepalensis
37225940TC652634.771.00DOWNSTREAM(|2389||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|2224||None|Vigan.11G249600.01)Vigna nepalensis
37225952CA633006.771.00DOWNSTREAM(|2377||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|2236||None|Vigan.11G249600.01)Vigna nepalensis
37225953AG643047.771.00DOWNSTREAM(|2376||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|2237||None|Vigan.11G249600.01)Vigna nepalensis
37225961AG703143.771.00DOWNSTREAM(|2368||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|2245||None|Vigan.11G249600.01)Vigna nepalensis
37225992GA732991.771.00DOWNSTREAM(|2337||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|2276||None|Vigan.11G249600.01)Vigna nepalensis
37226020TC762954.771.00DOWNSTREAM(|2309||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|2304||None|Vigan.11G249600.01)Vigna nepalensis
37226031CT712807.771.00DOWNSTREAM(|2298||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|2315||None|Vigan.11G249600.01)Vigna nepalensis
37226064TC572182.771.00DOWNSTREAM(|2265||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|2348||None|Vigan.11G249600.01)Vigna nepalensis
37226079TG492195.771.00DOWNSTREAM(|2250||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|2363||None|Vigan.11G249600.01)Vigna nepalensis
37226083GT502211.771.00DOWNSTREAM(|2246||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|2367||None|Vigan.11G249600.01)Vigna nepalensis
37226130CT411713.771.00DOWNSTREAM(|2199||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|2414||None|Vigan.11G249600.01)Vigna nepalensis
37226155GC421767.771.00DOWNSTREAM(|2174||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|2439||None|Vigan.11G249600.01)Vigna nepalensis
37226203TA572321.771.00DOWNSTREAM(|2126||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|2487||None|Vigan.11G249600.01)Vigna nepalensis
37226230AT662776.771.00DOWNSTREAM(|2099||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|2514||None|Vigan.11G249600.01)Vigna nepalensis
37226594GA572117.771.00DOWNSTREAM(|1735||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|2878||None|Vigan.11G249600.01)Vigna nepalensis
37226691AG542400.771.00DOWNSTREAM(|1638||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), SPLICE_SITE_REGION(|||None|Vigan.11G249700.01), UPSTREAM(|2975||None|Vigan.11G249600.01)Vigna nepalensis
37226694TG502323.771.00DOWNSTREAM(|1635||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|2978||None|Vigan.11G249600.01)Vigna nepalensis
37226761GA552325.771.00DOWNSTREAM(|1568||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|3045||None|Vigan.11G249600.01)Vigna nepalensis
37226793AC632881.771.00DOWNSTREAM(|1536||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|3077||None|Vigan.11G249600.01)Vigna nepalensis
37226807GA642978.771.00DOWNSTREAM(|1522||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|3091||None|Vigan.11G249600.01)Vigna nepalensis
37226816CT642941.771.00DOWNSTREAM(|1513||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|3100||None|Vigan.11G249600.01)Vigna nepalensis
37226908AT532202.771.00DOWNSTREAM(|1421||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|3192||None|Vigan.11G249600.01)Vigna nepalensis
37226950AG552486.771.00DOWNSTREAM(|1379||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|3234||None|Vigan.11G249600.01)Vigna nepalensis
37226951AG562486.771.00DOWNSTREAM(|1378||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|3235||None|Vigan.11G249600.01)Vigna nepalensis
37226970GA582346.771.00DOWNSTREAM(|1359||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|3254||None|Vigan.11G249600.01)Vigna nepalensis
37226992TA592397.771.00DOWNSTREAM(|1337||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|3276||None|Vigan.11G249600.01)Vigna nepalensis
37227104CT682610.771.00DOWNSTREAM(|1225||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|3388||None|Vigan.11G249600.01)Vigna nepalensis
37227136TC682749.771.00DOWNSTREAM(|1193||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|3420||None|Vigan.11G249600.01)Vigna nepalensis
37227184AT612705.771.00DOWNSTREAM(|1145||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|3468||None|Vigan.11G249600.01)Vigna nepalensis
37227195CT632815.771.00DOWNSTREAM(|1134||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|3479||None|Vigan.11G249600.01)Vigna nepalensis
37227222GT642541.771.00DOWNSTREAM(|1107||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|3506||None|Vigan.11G249600.01)Vigna nepalensis
37227253CG662715.771.00DOWNSTREAM(|1076||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|3537||None|Vigan.11G249600.01)Vigna nepalensis
37227297CT612513.771.00DOWNSTREAM(|1032||None|Vigan.11G249800.01), SYNONYMOUS_CODING(SILENT|Cta/Tta|L164|None|Vigan.11G249700.01), UPSTREAM(|3581||None|Vigan.11G249600.01)Vigna nepalensis
37227352AT512279.771.00DOWNSTREAM(|977||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|3636||None|Vigan.11G249600.01)Vigna nepalensis
37227374AG542579.771.00DOWNSTREAM(|955||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|3658||None|Vigan.11G249600.01)Vigna nepalensis
37227377GT572626.771.00DOWNSTREAM(|952||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|3661||None|Vigan.11G249600.01)Vigna nepalensis
37227389TG552626.771.00DOWNSTREAM(|940||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|3673||None|Vigan.11G249600.01)Vigna nepalensis
37227403TC522464.771.00DOWNSTREAM(|926||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|3687||None|Vigan.11G249600.01)Vigna nepalensis
37227433AT592651.771.00DOWNSTREAM(|896||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|3717||None|Vigan.11G249600.01)Vigna nepalensis
37227435GT582696.771.00DOWNSTREAM(|894||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|3719||None|Vigan.11G249600.01)Vigna nepalensis
37227444TC572761.771.00DOWNSTREAM(|885||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|3728||None|Vigan.11G249600.01)Vigna nepalensis
37227463AG582760.771.00DOWNSTREAM(|866||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|3747||None|Vigan.11G249600.01)Vigna nepalensis
37227484GT582470.771.00DOWNSTREAM(|845||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|3768||None|Vigan.11G249600.01)Vigna nepalensis
37227517AG582266.771.00DOWNSTREAM(|812||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|3801||None|Vigan.11G249600.01)Vigna nepalensis
37227555CT532059.771.00DOWNSTREAM(|774||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|3839||None|Vigan.11G249600.01)Vigna nepalensis
37227606TC60777.770.35DOWNSTREAM(|723||None|Vigan.11G249800.01), SYNONYMOUS_CODING(SILENT|caT/caC|H189|None|Vigan.11G249700.01), UPSTREAM(|3890||None|Vigan.11G249600.01)Vigna nepalensis
37227616GA651045.770.40DOWNSTREAM(|713||None|Vigan.11G249800.01), NON_SYNONYMOUS_CODING(MISSENSE|Gaa/Aaa|E193K|None|Vigan.11G249700.01), UPSTREAM(|3900||None|Vigan.11G249600.01)Vigna nepalensis
37227629CT781255.770.46DOWNSTREAM(|700||None|Vigan.11G249800.01), NON_SYNONYMOUS_CODING(MISSENSE|gCt/gTt|A197V|None|Vigan.11G249700.01), UPSTREAM(|3913||None|Vigan.11G249600.01)Vigna nepalensis
37227787TA991858.770.46DOWNSTREAM(|542||None|Vigan.11G249800.01), UPSTREAM(|4071||None|Vigan.11G249600.01), UTR_3_PRIME(|94||None|Vigan.11G249700.01)Vigna nepalensis

Indels

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
37224477GAG522302.731.00DOWNSTREAM(|3851||None|Vigan.11G249800.01), DOWNSTREAM(|4852||None|Vigan.11G249500.01), UPSTREAM(|762||None|Vigan.11G249600.01), UTR_5_PRIME(|49||None|Vigan.11G249700.01)Vigna nepalensis
37224490GAG472077.731.00DOWNSTREAM(|3838||None|Vigan.11G249800.01), DOWNSTREAM(|4865||None|Vigan.11G249500.01), UPSTREAM(|775||None|Vigan.11G249600.01), UTR_5_PRIME(|36||None|Vigan.11G249700.01)Vigna nepalensis
37224517AATCAATCG542617.731.00DOWNSTREAM(|3811||None|Vigan.11G249800.01), DOWNSTREAM(|4892||None|Vigan.11G249500.01), UPSTREAM(|802||None|Vigan.11G249600.01), UTR_5_PRIME(|9||None|Vigan.11G249700.01)Vigna nepalensis
37224894GGA532325.731.00DOWNSTREAM(|3434||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|1179||None|Vigan.11G249600.01)Vigna nepalensis
37225410TTTTAT532320.731.00DOWNSTREAM(|2918||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|1695||None|Vigan.11G249600.01)Vigna nepalensis
37225653TTTGTAAATGAGTGCATAGATTAATA673787.731.00DOWNSTREAM(|2675||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|1938||None|Vigan.11G249600.01)Vigna nepalensis
37225764TTTAGATGCAAAGAATAAATTGTTTTTA452745.731.00DOWNSTREAM(|2564||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|2049||None|Vigan.11G249600.01)Vigna nepalensis
37226118AAC411684.731.00DOWNSTREAM(|2210||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|2403||None|Vigan.11G249600.01)Vigna nepalensis
37226177GGT431526.731.00DOWNSTREAM(|2151||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|2462||None|Vigan.11G249600.01)Vigna nepalensis
37226208ATCCTTAGA552427.731.00DOWNSTREAM(|2120||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|2493||None|Vigan.11G249600.01)Vigna nepalensis
37226243TTCTTTATGCATCATTTATATGACTCATGGACATTGTATGTTAT683039.731.00DOWNSTREAM(|2085||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|2528||None|Vigan.11G249600.01)Vigna nepalensis
37226291AAGTATCTCATTTATCAATGACTTGTTCTAGTTGCTGCGAAACAAAATGTTCAAGTGAACCATTCACCGATTTAAGGGGAAAGCTGGATAAAAAAAATTCTAATTCTTGATTTTACGA703155.731.00DOWNSTREAM(|2037||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|2576||None|Vigan.11G249600.01)Vigna nepalensis
37226822ATTA673013.731.00DOWNSTREAM(|1506||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|3107||None|Vigan.11G249600.01)Vigna nepalensis
37227063AGTTTTTA622737.731.00DOWNSTREAM(|1265||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|3348||None|Vigan.11G249600.01)Vigna nepalensis
37227071CCCGC622736.731.00DOWNSTREAM(|1257||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|3356||None|Vigan.11G249600.01)Vigna nepalensis
37227075ACGGAAATA612692.731.00DOWNSTREAM(|1253||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|3360||None|Vigan.11G249600.01)Vigna nepalensis
37227607AAGA60852.730.37DOWNSTREAM(|721||None|Vigan.11G249800.01), FRAME_SHIFT(|aag/|K190|None|Vigan.11G249700.01), UPSTREAM(|3892||None|Vigan.11G249600.01)Vigna nepalensis
37227808CTC1004642.731.00DOWNSTREAM(|520||None|Vigan.11G249800.01), UPSTREAM(|4093||None|Vigan.11G249600.01), UTR_3_PRIME(|116||None|Vigan.11G249700.01)Vigna nepalensis

SSR-associated indels

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
37225141(GT)10(GT)6451933.731.00DOWNSTREAM(|3187||None|Vigan.11G249800.01), INTRON(|||None|Vigan.11G249700.01), UPSTREAM(|1426||None|Vigan.11G249600.01)Vigna nepalensis