Variant information

Chr10:26791317 - 26795986

Filter



 [SNPs] [Indels]

SNPs

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
26791381CT401577.771.00UTR_5_PRIME(|56||None|Vigan.10G220600.01)Vigna nepalensis
26791639TC401538.771.00INTRON(|||None|Vigan.10G220600.01)Vigna nepalensis
26792003CT632438.771.00DOWNSTREAM(|4666||None|Vigan.10G220700.01), INTRON(|||None|Vigan.10G220600.01), SPLICE_SITE_REGION(|||None|Vigan.10G220600.01)Vigna nepalensis
26792070GA582371.771.00DOWNSTREAM(|4599||None|Vigan.10G220700.01), INTRON(|||None|Vigan.10G220600.01)Vigna nepalensis
26792219GT652327.771.00DOWNSTREAM(|4450||None|Vigan.10G220700.01), INTRON(|||None|Vigan.10G220600.01)Vigna nepalensis
26792341TC542192.771.00DOWNSTREAM(|4328||None|Vigan.10G220700.01), NON_SYNONYMOUS_CODING(MISSENSE|tTc/tCc|F133S|None|Vigan.10G220600.01)Vigna nepalensis
26792415AG582240.771.00DOWNSTREAM(|4254||None|Vigan.10G220700.01), NON_SYNONYMOUS_CODING(MISSENSE|Atc/Gtc|I158V|None|Vigan.10G220600.01)Vigna nepalensis
26792447GA532005.771.00DOWNSTREAM(|4222||None|Vigan.10G220700.01), INTRON(|||None|Vigan.10G220600.01), SPLICE_SITE_REGION(|||None|Vigan.10G220600.01)Vigna nepalensis
26792608AT481982.771.00DOWNSTREAM(|4061||None|Vigan.10G220700.01), INTRON(|||None|Vigan.10G220600.01)Vigna nepalensis
26792758GA482125.771.00DOWNSTREAM(|3911||None|Vigan.10G220700.01), INTRON(|||None|Vigan.10G220600.01)Vigna nepalensis
26792768GA452126.771.00DOWNSTREAM(|3901||None|Vigan.10G220700.01), INTRON(|||None|Vigan.10G220600.01)Vigna nepalensis
26792804TC492129.771.00DOWNSTREAM(|3865||None|Vigan.10G220700.01), INTRON(|||None|Vigan.10G220600.01)Vigna nepalensis
26793342AG612680.771.00DOWNSTREAM(|3327||None|Vigan.10G220700.01), INTRON(|||None|Vigan.10G220600.01)Vigna nepalensis
26793352AT592593.771.00DOWNSTREAM(|3317||None|Vigan.10G220700.01), INTRON(|||None|Vigan.10G220600.01)Vigna nepalensis
26793718TC411820.771.00DOWNSTREAM(|2951||None|Vigan.10G220700.01), INTRON(|||None|Vigan.10G220600.01)Vigna nepalensis
26793740GA401817.771.00DOWNSTREAM(|2929||None|Vigan.10G220700.01), INTRON(|||None|Vigan.10G220600.01)Vigna nepalensis
26793786TC391649.771.00DOWNSTREAM(|2883||None|Vigan.10G220700.01), INTRON(|||None|Vigan.10G220600.01)Vigna nepalensis
26793842TA562296.771.00DOWNSTREAM(|2827||None|Vigan.10G220700.01), INTRON(|||None|Vigan.10G220600.01)Vigna nepalensis
26794017CG572320.771.00DOWNSTREAM(|2652||None|Vigan.10G220700.01), INTRON(|||None|Vigan.10G220600.01)Vigna nepalensis
26794361TG542202.771.00DOWNSTREAM(|2308||None|Vigan.10G220700.01), INTRON(|||None|Vigan.10G220600.01)Vigna nepalensis
26794614AT572415.771.00DOWNSTREAM(|2055||None|Vigan.10G220700.01), INTRON(|||None|Vigan.10G220600.01)Vigna nepalensis
26794826GC592305.771.00DOWNSTREAM(|1843||None|Vigan.10G220700.01), INTRON(|||None|Vigan.10G220600.01)Vigna nepalensis
26794879CT542117.771.00DOWNSTREAM(|1790||None|Vigan.10G220700.01), INTRON(|||None|Vigan.10G220600.01)Vigna nepalensis
26794908TC592638.771.00DOWNSTREAM(|1761||None|Vigan.10G220700.01), INTRON(|||None|Vigan.10G220600.01)Vigna nepalensis
26794932CA602652.771.00DOWNSTREAM(|1737||None|Vigan.10G220700.01), INTRON(|||None|Vigan.10G220600.01)Vigna nepalensis
26795247CT622248.771.00DOWNSTREAM(|1422||None|Vigan.10G220700.01), SYNONYMOUS_CODING(SILENT|Cta/Tta|L336|None|Vigan.10G220600.01)Vigna nepalensis
26795336GT482288.771.00DOWNSTREAM(|1333||None|Vigan.10G220700.01), UTR_3_PRIME(|3||None|Vigan.10G220600.01)Vigna nepalensis
26795341CT522400.771.00DOWNSTREAM(|1328||None|Vigan.10G220700.01), UTR_3_PRIME(|8||None|Vigan.10G220600.01)Vigna nepalensis
26795352AC502263.771.00DOWNSTREAM(|1317||None|Vigan.10G220700.01), UTR_3_PRIME(|19||None|Vigan.10G220600.01)Vigna nepalensis
26795417GC632519.771.00DOWNSTREAM(|1252||None|Vigan.10G220700.01), UTR_3_PRIME(|84||None|Vigan.10G220600.01)Vigna nepalensis
26795505CT532263.771.00DOWNSTREAM(|1164||None|Vigan.10G220700.01), UTR_3_PRIME(|172||None|Vigan.10G220600.01)Vigna nepalensis
26795542TA522318.771.00DOWNSTREAM(|1127||None|Vigan.10G220700.01), UTR_3_PRIME(|209||None|Vigan.10G220600.01)Vigna nepalensis
26795552CA522432.771.00DOWNSTREAM(|1117||None|Vigan.10G220700.01), UTR_3_PRIME(|219||None|Vigan.10G220600.01)Vigna nepalensis
26795555TC522371.771.00DOWNSTREAM(|1114||None|Vigan.10G220700.01), UTR_3_PRIME(|222||None|Vigan.10G220600.01)Vigna nepalensis
26795726TA682701.771.00DOWNSTREAM(|943||None|Vigan.10G220700.01), UTR_3_PRIME(|393||None|Vigan.10G220600.01)Vigna nepalensis
26795742TC632423.771.00DOWNSTREAM(|927||None|Vigan.10G220700.01), UTR_3_PRIME(|409||None|Vigan.10G220600.01)Vigna nepalensis
26795768TA632484.771.00DOWNSTREAM(|901||None|Vigan.10G220700.01), UTR_3_PRIME(|435||None|Vigan.10G220600.01)Vigna nepalensis
26795833GC481911.771.00DOWNSTREAM(|836||None|Vigan.10G220700.01), UTR_3_PRIME(|500||None|Vigan.10G220600.01)Vigna nepalensis

Indels

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
26791347AAAGGAATT441987.731.00UTR_5_PRIME(|89||None|Vigan.10G220600.01)Vigna nepalensis
26792835TATGGATATTTCATTTTATGCTGAAATTTGTTTCTCAT391722.731.00DOWNSTREAM(|3833||None|Vigan.10G220700.01), INTRON(|||None|Vigan.10G220600.01)Vigna nepalensis
26793602ATTTTTA451932.731.00DOWNSTREAM(|3066||None|Vigan.10G220700.01), INTRON(|||None|Vigan.10G220600.01)Vigna nepalensis
26795334TCT462234.731.00DOWNSTREAM(|1334||None|Vigan.10G220700.01), UTR_3_PRIME(|2||None|Vigan.10G220600.01)Vigna nepalensis
26795390TTA622172.731.00DOWNSTREAM(|1278||None|Vigan.10G220700.01), UTR_3_PRIME(|58||None|Vigan.10G220600.01)Vigna nepalensis
26795643GTAGTCTTG522284.731.00DOWNSTREAM(|1025||None|Vigan.10G220700.01), UTR_3_PRIME(|311||None|Vigan.10G220600.01)Vigna nepalensis
26795692CCCTT562482.731.00DOWNSTREAM(|976||None|Vigan.10G220700.01), UTR_3_PRIME(|360||None|Vigan.10G220600.01)Vigna nepalensis
26795874CATC321391.731.00DOWNSTREAM(|794||None|Vigan.10G220700.01), UTR_3_PRIME(|542||None|Vigan.10G220600.01)Vigna nepalensis
26795887AAATG341608.731.00DOWNSTREAM(|781||None|Vigan.10G220700.01), UTR_3_PRIME(|555||None|Vigan.10G220600.01)Vigna nepalensis
26795891GGTGTATGGATCAAGAAATTTAATATAAATTGTTCATAAACAAAGAGTAACGCTGAAGAATGACGC362749.731.00DOWNSTREAM(|777||None|Vigan.10G220700.01), UTR_3_PRIME(|559||None|Vigan.10G220600.01)Vigna nepalensis