Variant information

Chr10:25283848 - 25286585

Filter



 [SNPs] [Indels]

SNPs

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
25284003GA391592.771.00DOWNSTREAM(|576||None|Vigan.10G200200.01), UTR_5_PRIME(|11||None|Vigan.10G200300.01)Vigna nepalensis
25284161CG461844.771.00DOWNSTREAM(|734||None|Vigan.10G200200.01), INTRON(|||None|Vigan.10G200300.01)Vigna nepalensis
25284189AG502257.771.00DOWNSTREAM(|762||None|Vigan.10G200200.01), INTRON(|||None|Vigan.10G200300.01)Vigna nepalensis
25284191AG512257.771.00DOWNSTREAM(|764||None|Vigan.10G200200.01), INTRON(|||None|Vigan.10G200300.01)Vigna nepalensis
25284522AG712867.771.00DOWNSTREAM(|1095||None|Vigan.10G200200.01), SYNONYMOUS_CODING(SILENT|caA/caG|Q72|None|Vigan.10G200300.01)Vigna nepalensis
25284595CA692640.771.00DOWNSTREAM(|1168||None|Vigan.10G200200.01), INTRON(|||None|Vigan.10G200300.01), UPSTREAM(|4940||None|Vigan.10G200400.01)Vigna nepalensis
25284625GC552284.771.00DOWNSTREAM(|1198||None|Vigan.10G200200.01), INTRON(|||None|Vigan.10G200300.01), UPSTREAM(|4910||None|Vigan.10G200400.01)Vigna nepalensis
25284672AG702815.771.00DOWNSTREAM(|1245||None|Vigan.10G200200.01), INTRON(|||None|Vigan.10G200300.01), UPSTREAM(|4863||None|Vigan.10G200400.01)Vigna nepalensis
25284862AT572368.771.00DOWNSTREAM(|1435||None|Vigan.10G200200.01), INTRON(|||None|Vigan.10G200300.01), UPSTREAM(|4673||None|Vigan.10G200400.01)Vigna nepalensis
25284916GA612480.771.00DOWNSTREAM(|1489||None|Vigan.10G200200.01), INTRON(|||None|Vigan.10G200300.01), UPSTREAM(|4619||None|Vigan.10G200400.01)Vigna nepalensis
25285079CT512081.771.00DOWNSTREAM(|1652||None|Vigan.10G200200.01), INTRON(|||None|Vigan.10G200300.01), UPSTREAM(|4456||None|Vigan.10G200400.01)Vigna nepalensis
25285160TA471907.771.00DOWNSTREAM(|1733||None|Vigan.10G200200.01), SYNONYMOUS_CODING(SILENT|gcT/gcA|A150|None|Vigan.10G200300.01), UPSTREAM(|4375||None|Vigan.10G200400.01)Vigna nepalensis
25285218CT592454.771.00DOWNSTREAM(|1791||None|Vigan.10G200200.01), INTRON(|||None|Vigan.10G200300.01), UPSTREAM(|4317||None|Vigan.10G200400.01)Vigna nepalensis
25285395GC612487.771.00DOWNSTREAM(|1968||None|Vigan.10G200200.01), INTRON(|||None|Vigan.10G200300.01), UPSTREAM(|4140||None|Vigan.10G200400.01)Vigna nepalensis
25285435AT732918.771.00DOWNSTREAM(|2008||None|Vigan.10G200200.01), INTRON(|||None|Vigan.10G200300.01), UPSTREAM(|4100||None|Vigan.10G200400.01)Vigna nepalensis
25285539TC582282.771.00DOWNSTREAM(|2112||None|Vigan.10G200200.01), INTRON(|||None|Vigan.10G200300.01), UPSTREAM(|3996||None|Vigan.10G200400.01)Vigna nepalensis
25285794AC632506.771.00DOWNSTREAM(|2367||None|Vigan.10G200200.01), INTRON(|||None|Vigan.10G200300.01), UPSTREAM(|3741||None|Vigan.10G200400.01)Vigna nepalensis
25285831CT662540.771.00DOWNSTREAM(|2404||None|Vigan.10G200200.01), INTRON(|||None|Vigan.10G200300.01), UPSTREAM(|3704||None|Vigan.10G200400.01)Vigna nepalensis
25285852AG652935.771.00DOWNSTREAM(|2425||None|Vigan.10G200200.01), INTRON(|||None|Vigan.10G200300.01), UPSTREAM(|3683||None|Vigan.10G200400.01)Vigna nepalensis
25285862GA683043.771.00DOWNSTREAM(|2435||None|Vigan.10G200200.01), INTRON(|||None|Vigan.10G200300.01), UPSTREAM(|3673||None|Vigan.10G200400.01)Vigna nepalensis
25286006CT462056.771.00DOWNSTREAM(|2579||None|Vigan.10G200200.01), INTRON(|||None|Vigan.10G200300.01), UPSTREAM(|3529||None|Vigan.10G200400.01)Vigna nepalensis
25286018CT482099.771.00DOWNSTREAM(|2591||None|Vigan.10G200200.01), INTRON(|||None|Vigan.10G200300.01), UPSTREAM(|3517||None|Vigan.10G200400.01)Vigna nepalensis
25286103CT532110.771.00DOWNSTREAM(|2676||None|Vigan.10G200200.01), INTRON(|||None|Vigan.10G200300.01), UPSTREAM(|3432||None|Vigan.10G200400.01)Vigna nepalensis
25286210AG441789.771.00DOWNSTREAM(|2783||None|Vigan.10G200200.01), NON_SYNONYMOUS_CODING(MISSENSE|Agg/Ggg|R228G|None|Vigan.10G200300.01), UPSTREAM(|3325||None|Vigan.10G200400.01)Vigna nepalensis
25286225GA471847.771.00DOWNSTREAM(|2798||None|Vigan.10G200200.01), UPSTREAM(|3310||None|Vigan.10G200400.01), UTR_3_PRIME(|10||None|Vigan.10G200300.01)Vigna nepalensis
25286290AT632465.771.00DOWNSTREAM(|2863||None|Vigan.10G200200.01), UPSTREAM(|3245||None|Vigan.10G200400.01), UTR_3_PRIME(|75||None|Vigan.10G200300.01)Vigna nepalensis
25286305GT622492.771.00DOWNSTREAM(|2878||None|Vigan.10G200200.01), UPSTREAM(|3230||None|Vigan.10G200400.01), UTR_3_PRIME(|90||None|Vigan.10G200300.01)Vigna nepalensis
25286392TC512015.771.00DOWNSTREAM(|2965||None|Vigan.10G200200.01), UPSTREAM(|3143||None|Vigan.10G200400.01), UTR_3_PRIME(|177||None|Vigan.10G200300.01)Vigna nepalensis
25286489GA452092.771.00DOWNSTREAM(|3062||None|Vigan.10G200200.01), UPSTREAM(|3046||None|Vigan.10G200400.01), UTR_3_PRIME(|274||None|Vigan.10G200300.01)Vigna nepalensis
25286550AG281219.771.00DOWNSTREAM(|3123||None|Vigan.10G200200.01), UPSTREAM(|2985||None|Vigan.10G200400.01), UTR_3_PRIME(|335||None|Vigan.10G200300.01)Vigna nepalensis
25286560CT251140.771.00DOWNSTREAM(|3133||None|Vigan.10G200200.01), UPSTREAM(|2975||None|Vigan.10G200400.01), UTR_3_PRIME(|345||None|Vigan.10G200300.01)Vigna nepalensis
25286562AT231096.771.00DOWNSTREAM(|3135||None|Vigan.10G200200.01), UPSTREAM(|2973||None|Vigan.10G200400.01), UTR_3_PRIME(|347||None|Vigan.10G200300.01)Vigna nepalensis

Indels

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
25284091TCT381305.731.00DOWNSTREAM(|665||None|Vigan.10G200200.01), INTRON(|||None|Vigan.10G200300.01)Vigna nepalensis
25284212GTG421654.731.00DOWNSTREAM(|786||None|Vigan.10G200200.01), INTRON(|||None|Vigan.10G200300.01)Vigna nepalensis
25285037CCATGTAAGTA693230.731.00DOWNSTREAM(|1611||None|Vigan.10G200200.01), INTRON(|||None|Vigan.10G200300.01), UPSTREAM(|4497||None|Vigan.10G200400.01)Vigna nepalensis
25285247TTAC632866.731.00DOWNSTREAM(|1821||None|Vigan.10G200200.01), INTRON(|||None|Vigan.10G200300.01), UPSTREAM(|4287||None|Vigan.10G200400.01)Vigna nepalensis
25285308CCTTG652911.731.00DOWNSTREAM(|1882||None|Vigan.10G200200.01), INTRON(|||None|Vigan.10G200300.01), UPSTREAM(|4226||None|Vigan.10G200400.01)Vigna nepalensis
25286420CCATAGAACCAAATTACTTC472060.731.00DOWNSTREAM(|2994||None|Vigan.10G200200.01), UPSTREAM(|3114||None|Vigan.10G200400.01), UTR_3_PRIME(|206||None|Vigan.10G200300.01)Vigna nepalensis
25286475TACT522302.731.00DOWNSTREAM(|3049||None|Vigan.10G200200.01), UPSTREAM(|3059||None|Vigan.10G200400.01), UTR_3_PRIME(|261||None|Vigan.10G200300.01)Vigna nepalensis
25286564CCT20997.731.00DOWNSTREAM(|3138||None|Vigan.10G200200.01), UPSTREAM(|2970||None|Vigan.10G200400.01), UTR_3_PRIME(|350||None|Vigan.10G200300.01)Vigna nepalensis