Variant information

Chr10:24150798 - 24160827

Filter



 [SNPs] [Indels]

SNPs

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
24150931CG431893.771.00UPSTREAM(|3590||None|Vigan.10G187200.01), UTR_5_PRIME(|88||None|Vigan.10G187300.01)Vigna nepalensis
24151263TC431721.771.00INTRON(|||None|Vigan.10G187300.01), UPSTREAM(|3922||None|Vigan.10G187200.01)Vigna nepalensis
24151824CT532019.771.00INTRON(|||None|Vigan.10G187300.01), UPSTREAM(|4483||None|Vigan.10G187200.01)Vigna nepalensis
24151885CT471909.771.00INTRON(|||None|Vigan.10G187300.01), UPSTREAM(|4544||None|Vigan.10G187200.01)Vigna nepalensis
24151956AT652524.771.00INTRON(|||None|Vigan.10G187300.01), UPSTREAM(|4615||None|Vigan.10G187200.01)Vigna nepalensis
24152304TA471822.771.00INTRON(|||None|Vigan.10G187300.01), UPSTREAM(|4963||None|Vigan.10G187200.01)Vigna nepalensis
24152354TC401521.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24152550AT441799.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24152967CT722891.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24153105AG602705.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24153109TC632784.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24153219CT682758.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24153258TC502003.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24153392CA471925.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24153562CT552184.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24153735TG391620.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24153892GT351230.770.94INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24153935GT361404.770.94INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24153945AC331428.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24154033GA481696.770.96INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24154082GA511806.770.96INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24154148GA441719.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24154346TC401596.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24154387CT371485.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24154466AC301304.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24154476GA331387.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24154504CT401774.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24154513AG421817.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24154535GA451720.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24154554AG501874.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24154666GA381444.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24154730TC281121.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24154819AG361445.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24154942CT271036.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24154993TC331279.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24155035AG491911.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24155215AC552150.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24155373AG371375.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24155621TC501929.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24155698GT421674.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24155713CT411612.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24155744GA421645.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24155844GT431697.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24155873GA441893.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24155883AT411849.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24156015CA391518.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24156041TC361431.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24156137CT552144.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24156157GT572223.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24156400AG391574.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24156583TG532071.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24156607AG582266.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24156659AG562092.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24156672GA592691.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24156677CT582697.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24156832GA431720.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24156930AC451769.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24156966AG361568.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24156967GA361568.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24157014GA501999.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24157050GT592150.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24157083GA481782.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24157135TA321269.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24157153AT271077.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24157166AG281121.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24157194AG451733.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24157332GA542082.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24157447AG592404.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24157461AG602431.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24157595TC511947.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24157668TC481897.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24157834GA592173.771.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24158018GA562132.771.00DOWNSTREAM(|4829||None|Vigan.10G187400.01), INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24158037CT592299.771.00DOWNSTREAM(|4810||None|Vigan.10G187400.01), INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24158070TG562126.771.00DOWNSTREAM(|4777||None|Vigan.10G187400.01), INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24158186TC451881.771.00DOWNSTREAM(|4661||None|Vigan.10G187400.01), INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24158451AG391609.771.00DOWNSTREAM(|4396||None|Vigan.10G187400.01), INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24158794AC642525.771.00DOWNSTREAM(|4053||None|Vigan.10G187400.01), INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24158822GA612429.771.00DOWNSTREAM(|4025||None|Vigan.10G187400.01), INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24158916TC492045.771.00DOWNSTREAM(|3931||None|Vigan.10G187400.01), INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24159472GT461750.771.00DOWNSTREAM(|3375||None|Vigan.10G187400.01), NON_SYNONYMOUS_CODING(MISSENSE|atG/atT|M87I|None|Vigan.10G187300.01)Vigna nepalensis
24160241AG522125.771.00DOWNSTREAM(|2606||None|Vigan.10G187400.01), UTR_3_PRIME(|12||None|Vigan.10G187300.01)Vigna nepalensis

Indels

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
24150925TTA381778.731.00UPSTREAM(|3585||None|Vigan.10G187200.01), UTR_5_PRIME(|93||None|Vigan.10G187300.01)Vigna nepalensis
24151661TTA632454.731.00INTRON(|||None|Vigan.10G187300.01), UPSTREAM(|4321||None|Vigan.10G187200.01)Vigna nepalensis
24151702TAAT612652.731.00INTRON(|||None|Vigan.10G187300.01), UPSTREAM(|4362||None|Vigan.10G187200.01)Vigna nepalensis
24152114ATA511422.731.00INTRON(|||None|Vigan.10G187300.01), UPSTREAM(|4774||None|Vigan.10G187200.01)Vigna nepalensis
24152456TTAGTA602695.731.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24155759CCCCA492160.731.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24156460AGA431495.731.00INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24158632TTGGTGTGTTAGTCTGGGTGTGTTAGTCTGGGTGTGTTAGTCTGGGTGTGTTAGTCTG332787.731.00DOWNSTREAM(|4214||None|Vigan.10G187400.01), INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis
24158751TTAGGTATAAAGT582540.731.00DOWNSTREAM(|4095||None|Vigan.10G187400.01), INTRON(|||None|Vigan.10G187300.01)Vigna nepalensis