Variant information

Chr09:6959633 - 6962012

Filter



 [SNPs] [Indels]

SNPs

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
6960011GA12462.771.00UTR_5_PRIME(|399||None|Vigan.09G052900.01)Vigna nepalensis
6960015TG9402.771.00START_GAINED(|||None|Vigan.09G052900.01), UTR_5_PRIME(|395||None|Vigan.09G052900.01)Vigna nepalensis
6961089AT7255.81.00DOWNSTREAM(|4632||None|Vigan.09G053000.01), INTRON(|||None|Vigan.09G052900.01), UPSTREAM(|4633||None|Vigan.09G053100.01)Vigna nepalensis
6961126GA15568.771.00DOWNSTREAM(|4595||None|Vigan.09G053000.01), INTRON(|||None|Vigan.09G052900.01), UPSTREAM(|4596||None|Vigan.09G053100.01)Vigna nepalensis
6961182TA21820.771.00DOWNSTREAM(|4539||None|Vigan.09G053000.01), INTRON(|||None|Vigan.09G052900.01), UPSTREAM(|4540||None|Vigan.09G053100.01)Vigna nepalensis
6961643CG682327.771.00DOWNSTREAM(|4078||None|Vigan.09G053000.01), SYNONYMOUS_CODING(SILENT|gcC/gcG|A138|None|Vigan.09G052900.01), UPSTREAM(|4079||None|Vigan.09G053100.01)Vigna nepalensis
6961942GA662206.771.00DOWNSTREAM(|3779||None|Vigan.09G053000.01), UPSTREAM(|3780||None|Vigan.09G053100.01), UTR_3_PRIME(|119||None|Vigan.09G052900.01)Vigna nepalensis
6961992TC511717.771.00DOWNSTREAM(|3729||None|Vigan.09G053000.01), UPSTREAM(|3730||None|Vigan.09G053100.01), UTR_3_PRIME(|169||None|Vigan.09G052900.01)Vigna nepalensis

Indels

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
6961387ATGTGCACAGTATAATTGTTTCATTA251048.731.00DOWNSTREAM(|4333||None|Vigan.09G053000.01), INTRON(|||None|Vigan.09G052900.01), UPSTREAM(|4334||None|Vigan.09G053100.01)Vigna nepalensis