Variant information

Chr09:5924354 - 5932027

Filter



 [SNPs] [Indels]

SNPs

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
5925253CT471926.771.00EXON(|||None|Vigan.09G045000.01), INTRON(|||None|Vigan.09G045100.01)Vigna nepalensis
5925302AT492167.771.00EXON(|||None|Vigan.09G045000.01), INTRON(|||None|Vigan.09G045100.01)Vigna nepalensis
5925356CT281321.771.00EXON(|||None|Vigan.09G045000.01), INTRON(|||None|Vigan.09G045100.01)Vigna nepalensis
5925468AG371554.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|74||None|Vigan.09G045000.01)Vigna nepalensis
5925553AG431660.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|159||None|Vigan.09G045000.01)Vigna nepalensis
5925669CA371562.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|275||None|Vigan.09G045000.01)Vigna nepalensis
5925780AG491994.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|386||None|Vigan.09G045000.01)Vigna nepalensis
5925854CT532084.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|460||None|Vigan.09G045000.01)Vigna nepalensis
5925962TA612711.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|568||None|Vigan.09G045000.01)Vigna nepalensis
5925995GA562581.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|601||None|Vigan.09G045000.01)Vigna nepalensis
5926022GA582710.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|628||None|Vigan.09G045000.01)Vigna nepalensis
5926028CT542433.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|634||None|Vigan.09G045000.01)Vigna nepalensis
5926057GA542050.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|663||None|Vigan.09G045000.01)Vigna nepalensis
5926088GA552233.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|694||None|Vigan.09G045000.01)Vigna nepalensis
5926218AC482036.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|824||None|Vigan.09G045000.01)Vigna nepalensis
5926335AC442011.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|941||None|Vigan.09G045000.01)Vigna nepalensis
5926495GC381681.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|1101||None|Vigan.09G045000.01)Vigna nepalensis
5926527TC371610.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|1133||None|Vigan.09G045000.01)Vigna nepalensis
5926530CA371790.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|1136||None|Vigan.09G045000.01)Vigna nepalensis
5926551CT401816.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|1157||None|Vigan.09G045000.01)Vigna nepalensis
5926628TG351397.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|1234||None|Vigan.09G045000.01)Vigna nepalensis
5926718CA482293.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|1324||None|Vigan.09G045000.01)Vigna nepalensis
5926734GA612621.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|1340||None|Vigan.09G045000.01)Vigna nepalensis
5926760CT693150.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|1366||None|Vigan.09G045000.01)Vigna nepalensis
5926767CA703127.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|1373||None|Vigan.09G045000.01)Vigna nepalensis
5927199GA8269.781.00SYNONYMOUS_CODING(SILENT|acG/acA|T38|None|Vigan.09G045100.01), UPSTREAM(|1805||None|Vigan.09G045000.01)Vigna nepalensis
5927214TC9297.781.00SYNONYMOUS_CODING(SILENT|gtT/gtC|V43|None|Vigan.09G045100.01), UPSTREAM(|1820||None|Vigan.09G045000.01)Vigna nepalensis
5927225TC12407.771.00NON_SYNONYMOUS_CODING(MISSENSE|gTt/gCt|V47A|None|Vigan.09G045100.01), UPSTREAM(|1831||None|Vigan.09G045000.01)Vigna nepalensis
5927304CA26824.771.00SYNONYMOUS_CODING(SILENT|ccC/ccA|P73|None|Vigan.09G045100.01), UPSTREAM(|1910||None|Vigan.09G045000.01)Vigna nepalensis
5927358AC7216.81.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|1964||None|Vigan.09G045000.01)Vigna nepalensis
5927427GT7268.81.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|2033||None|Vigan.09G045000.01)Vigna nepalensis
5927444AG12468.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|2050||None|Vigan.09G045000.01)Vigna nepalensis
5927471CT351591.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|2077||None|Vigan.09G045000.01)Vigna nepalensis
5927474AT371726.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|2080||None|Vigan.09G045000.01)Vigna nepalensis
5927478GT401816.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|2084||None|Vigan.09G045000.01)Vigna nepalensis
5927493TG472086.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|2099||None|Vigan.09G045000.01)Vigna nepalensis
5927499GC452176.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|2105||None|Vigan.09G045000.01)Vigna nepalensis
5927500GA462131.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|2106||None|Vigan.09G045000.01)Vigna nepalensis
5927508AG451996.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|2114||None|Vigan.09G045000.01)Vigna nepalensis
5927528TA451996.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|2134||None|Vigan.09G045000.01)Vigna nepalensis
5927545CA441951.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|2151||None|Vigan.09G045000.01)Vigna nepalensis
5927571AG452131.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|2177||None|Vigan.09G045000.01)Vigna nepalensis
5927572CT442131.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|2178||None|Vigan.09G045000.01)Vigna nepalensis
5927600GA462086.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|2206||None|Vigan.09G045000.01)Vigna nepalensis
5927621GT482098.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|2227||None|Vigan.09G045000.01)Vigna nepalensis
5927631AG512226.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|2237||None|Vigan.09G045000.01)Vigna nepalensis
5927715AG452026.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|2321||None|Vigan.09G045000.01)Vigna nepalensis
5927738AT472201.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|2344||None|Vigan.09G045000.01)Vigna nepalensis
5927755AG522311.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|2361||None|Vigan.09G045000.01)Vigna nepalensis
5927776TC562599.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|2382||None|Vigan.09G045000.01)Vigna nepalensis
5927822AT572520.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|2428||None|Vigan.09G045000.01)Vigna nepalensis
5927825TA562520.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|2431||None|Vigan.09G045000.01)Vigna nepalensis
5927950TA472031.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|2556||None|Vigan.09G045000.01)Vigna nepalensis
5927974TC512146.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|2580||None|Vigan.09G045000.01)Vigna nepalensis
5928087AT491889.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|2693||None|Vigan.09G045000.01)Vigna nepalensis
5928437AT6241.841.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|3043||None|Vigan.09G045000.01)Vigna nepalensis
5928933GA16626.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|3539||None|Vigan.09G045000.01)Vigna nepalensis
5929023TG20720.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|3629||None|Vigan.09G045000.01)Vigna nepalensis
5929034CG22787.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|3640||None|Vigan.09G045000.01)Vigna nepalensis
5929166GA672402.771.00SYNONYMOUS_CODING(SILENT|acG/acA|T120|None|Vigan.09G045100.01), UPSTREAM(|3772||None|Vigan.09G045000.01)Vigna nepalensis
5929374CT481916.771.00SYNONYMOUS_CODING(SILENT|ccC/ccT|P164|None|Vigan.09G045100.01), UPSTREAM(|3980||None|Vigan.09G045000.01)Vigna nepalensis
5929512AC562153.771.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|4118||None|Vigan.09G045000.01)Vigna nepalensis
5929567AT391528.771.00SYNONYMOUS_CODING(SILENT|acA/acT|T182|None|Vigan.09G045100.01), UPSTREAM(|4173||None|Vigan.09G045000.01)Vigna nepalensis
5929877AT311014.771.00SYNONYMOUS_CODING(SILENT|ccA/ccT|P236|None|Vigan.09G045100.01), UPSTREAM(|4483||None|Vigan.09G045000.01)Vigna nepalensis
5930895GA11502.771.00INTRON(|||None|Vigan.09G045100.01)Vigna nepalensis
5931061CT301212.771.00SYNONYMOUS_CODING(SILENT|taC/taT|Y387|None|Vigan.09G045100.01)Vigna nepalensis
5931304AG612523.771.00INTRON(|||None|Vigan.09G045100.01)Vigna nepalensis
5931503AG532234.771.00INTRON(|||None|Vigan.09G045100.01)Vigna nepalensis
5931847AT502303.771.00UTR_3_PRIME(|134||None|Vigan.09G045100.01)Vigna nepalensis
5931848TA502348.771.00UTR_3_PRIME(|135||None|Vigan.09G045100.01)Vigna nepalensis
5931871GT552413.771.00UTR_3_PRIME(|158||None|Vigan.09G045100.01)Vigna nepalensis
5931989CT552476.771.00UTR_3_PRIME(|276||None|Vigan.09G045100.01)Vigna nepalensis

Indels

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
5925324GATG452108.731.00EXON(|||None|Vigan.09G045000.01), INTRON(|||None|Vigan.09G045100.01)Vigna nepalensis
5925388TCACCCT251216.731.00EXON(|||None|Vigan.09G045000.01), INTRON(|||None|Vigan.09G045100.01)Vigna nepalensis
5925400CATACATATATATC,
CAT
71134.730.71INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|7||None|Vigan.09G045000.01), UPSTREAM(|9||None|Vigan.09G045000.01)Vigna nepalensis
5925627TATTAACTTTTTACTTTACT381672.731.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|234||None|Vigan.09G045000.01)Vigna nepalensis
5925980AGTA582684.731.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|587||None|Vigan.09G045000.01)Vigna nepalensis
5926005TTTCT562617.731.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|612||None|Vigan.09G045000.01)Vigna nepalensis
5926272TAT341049.731.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|879||None|Vigan.09G045000.01)Vigna nepalensis
5926341ATA482124.731.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|948||None|Vigan.09G045000.01)Vigna nepalensis
5926355GGT441893.731.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|962||None|Vigan.09G045000.01)Vigna nepalensis
5926434TTTATCGAAATATTATTAATTTATATAATAAAGAAAATAATTAAAAAA231527.731.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|1041||None|Vigan.09G045000.01)Vigna nepalensis
5926496ATA381672.731.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|1103||None|Vigan.09G045000.01)Vigna nepalensis
5926547AAT371672.731.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|1154||None|Vigan.09G045000.01)Vigna nepalensis
5926555TTTA361672.731.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|1162||None|Vigan.09G045000.01)Vigna nepalensis
5926577TGGGTCTATTCTGAAAAAGGAGAAT351582.731.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|1184||None|Vigan.09G045000.01)Vigna nepalensis
5926714TTA452116.731.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|1321||None|Vigan.09G045000.01)Vigna nepalensis
5926827TTTA391653.731.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|1434||None|Vigan.09G045000.01)Vigna nepalensis
5926857TAT24687.731.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|1464||None|Vigan.09G045000.01)Vigna nepalensis
5927178GGAGATCT5232.81.00CODON_INSERTION(|aga/AGATCTaga|R32RSR|None|Vigan.09G045100.01), UPSTREAM(|1785||None|Vigan.09G045000.01)Vigna nepalensis
5927551TTC431897.731.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|2158||None|Vigan.09G045000.01)Vigna nepalensis
5927555TTC401942.731.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|2162||None|Vigan.09G045000.01)Vigna nepalensis
5927582CCA441987.731.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|2189||None|Vigan.09G045000.01)Vigna nepalensis
5927788ATA572505.731.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|2395||None|Vigan.09G045000.01)Vigna nepalensis
5927857TAT451399.731.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|2464||None|Vigan.09G045000.01)Vigna nepalensis
5927908CCTACACAATTTAAAA412067.731.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|2515||None|Vigan.09G045000.01)Vigna nepalensis
5928053TGT511619.731.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|2660||None|Vigan.09G045000.01)Vigna nepalensis
5928434TAT6232.81.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|3041||None|Vigan.09G045000.01)Vigna nepalensis
5929829TTGATC291342.731.00INTRON(|||None|Vigan.09G045100.01), UPSTREAM(|4436||None|Vigan.09G045000.01)Vigna nepalensis
5930832AGA5187.871.00INTRON(|||None|Vigan.09G045100.01)Vigna nepalensis
5930835CCTTC5187.871.00INTRON(|||None|Vigan.09G045100.01)Vigna nepalensis
5930901CTC12493.731.00INTRON(|||None|Vigan.09G045100.01)Vigna nepalensis
5931766AATACGTG411095.730.80UTR_3_PRIME(|54||None|Vigan.09G045100.01)Vigna nepalensis
5931768AACGTG46111.730.17UTR_3_PRIME(|56||None|Vigan.09G045100.01)Vigna nepalensis
5931995CCAT552552.731.00UTR_3_PRIME(|283||None|Vigan.09G045100.01)Vigna nepalensis
5931997GGA532469.731.00UTR_3_PRIME(|285||None|Vigan.09G045100.01)Vigna nepalensis