Variant information

Chr09:34369641 - 34374516

Filter



 [SNPs] [Indels]

SNPs

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
34369660AT431846.771.00DOWNSTREAM(|2865||None|Vigan.09G197700.01), UTR_5_PRIME(|234||None|Vigan.09G197800.01)Vigna nepalensis
34369810CT471850.771.00DOWNSTREAM(|3015||None|Vigan.09G197700.01), UTR_5_PRIME(|84||None|Vigan.09G197800.01)Vigna nepalensis
34371619TG612459.771.00DOWNSTREAM(|4824||None|Vigan.09G197700.01), INTRON(|||None|Vigan.09G197800.01), UPSTREAM(|3883||None|Vigan.09G197900.01)Vigna nepalensis
34371680CG662679.771.00DOWNSTREAM(|4885||None|Vigan.09G197700.01), INTRON(|||None|Vigan.09G197800.01), UPSTREAM(|3822||None|Vigan.09G197900.01)Vigna nepalensis
34372145CG652613.771.00INTRON(|||None|Vigan.09G197800.01), UPSTREAM(|3357||None|Vigan.09G197900.01)Vigna nepalensis
34372848AG662581.771.00INTRON(|||None|Vigan.09G197800.01), UPSTREAM(|2654||None|Vigan.09G197900.01)Vigna nepalensis
34373372AC612379.771.00INTRON(|||None|Vigan.09G197800.01), UPSTREAM(|2130||None|Vigan.09G197900.01)Vigna nepalensis
34374110CT572177.771.00UPSTREAM(|1392||None|Vigan.09G197900.01), UTR_3_PRIME(|67||None|Vigan.09G197800.01)Vigna nepalensis

Indels

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
34369674AAAG492183.731.00DOWNSTREAM(|2880||None|Vigan.09G197700.01), UTR_5_PRIME(|219||None|Vigan.09G197800.01)Vigna nepalensis
34369677GGAAAAAAAAGA432231.731.00DOWNSTREAM(|2883||None|Vigan.09G197700.01), UTR_5_PRIME(|216||None|Vigan.09G197800.01)Vigna nepalensis
34369765TTA441608.731.00DOWNSTREAM(|2971||None|Vigan.09G197700.01), UTR_5_PRIME(|128||None|Vigan.09G197800.01)Vigna nepalensis
34370085GGT28623.730.93DOWNSTREAM(|3291||None|Vigan.09G197700.01), INTRON(|||None|Vigan.09G197800.01)Vigna nepalensis
34371333CCT521776.731.00DOWNSTREAM(|4539||None|Vigan.09G197700.01), INTRON(|||None|Vigan.09G197800.01), UPSTREAM(|4168||None|Vigan.09G197900.01)Vigna nepalensis
34372064CCTCTTCTAGCTCCAAACAACATACCATAGAGAAAGG532836.731.00INTRON(|||None|Vigan.09G197800.01), UPSTREAM(|3437||None|Vigan.09G197900.01)Vigna nepalensis
34372106ATA541979.731.00INTRON(|||None|Vigan.09G197800.01), UPSTREAM(|3395||None|Vigan.09G197900.01)Vigna nepalensis