Variant information

Chr08:6705519 - 6709393

Filter



 [SNPs] [Indels]

SNPs

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
6705541TA491908.771.00DOWNSTREAM(|4643||None|Vigan.08G082700.01), UTR_5_PRIME(|158||None|Vigan.08G082600.01)Vigna nepalensis
6706469TA471825.771.00DOWNSTREAM(|3715||None|Vigan.08G082700.01), INTRON(|||None|Vigan.08G082600.01)Vigna nepalensis
6707196AT481986.771.00DOWNSTREAM(|2988||None|Vigan.08G082700.01), INTRON(|||None|Vigan.08G082600.01)Vigna nepalensis
6707283CT502015.771.00DOWNSTREAM(|2901||None|Vigan.08G082700.01), INTRON(|||None|Vigan.08G082600.01)Vigna nepalensis
6707363AG622542.771.00DOWNSTREAM(|2821||None|Vigan.08G082700.01), INTRON(|||None|Vigan.08G082600.01)Vigna nepalensis
6707443CT582570.771.00DOWNSTREAM(|2741||None|Vigan.08G082700.01), INTRON(|||None|Vigan.08G082600.01)Vigna nepalensis
6707445AC592570.771.00DOWNSTREAM(|2739||None|Vigan.08G082700.01), INTRON(|||None|Vigan.08G082600.01)Vigna nepalensis
6707469GA501973.771.00DOWNSTREAM(|2715||None|Vigan.08G082700.01), INTRON(|||None|Vigan.08G082600.01)Vigna nepalensis
6707492CT612475.771.00DOWNSTREAM(|2692||None|Vigan.08G082700.01), INTRON(|||None|Vigan.08G082600.01)Vigna nepalensis
6707738TG833221.921.00DOWNSTREAM(|2446||None|Vigan.08G082700.01), INTRON(|||None|Vigan.08G082600.01)Vigna nepalensis
6708280AG562121.771.00DOWNSTREAM(|1904||None|Vigan.08G082700.01), INTRON(|||None|Vigan.08G082600.01), SPLICE_SITE_REGION(|||None|Vigan.08G082600.01)Vigna nepalensis
6708310TC462012.771.00DOWNSTREAM(|1874||None|Vigan.08G082700.01), INTRON(|||None|Vigan.08G082600.01)Vigna nepalensis
6708317GA442012.771.00DOWNSTREAM(|1867||None|Vigan.08G082700.01), INTRON(|||None|Vigan.08G082600.01)Vigna nepalensis
6708463TC25973.771.00DOWNSTREAM(|1721||None|Vigan.08G082700.01), INTRON(|||None|Vigan.08G082600.01)Vigna nepalensis
6708513GA10420.771.00DOWNSTREAM(|1671||None|Vigan.08G082700.01), INTRON(|||None|Vigan.08G082600.01)Vigna nepalensis
6708640CA30148.770.17DOWNSTREAM(|1544||None|Vigan.08G082700.01), INTRON(|||None|Vigan.08G082600.01)Vigna nepalensis
6708642CA31148.770.19DOWNSTREAM(|1542||None|Vigan.08G082700.01), INTRON(|||None|Vigan.08G082600.01)Vigna nepalensis
6708762TC361419.771.00DOWNSTREAM(|1422||None|Vigan.08G082700.01), INTRON(|||None|Vigan.08G082600.01)Vigna nepalensis
6708800CT271107.771.00DOWNSTREAM(|1384||None|Vigan.08G082700.01), SYNONYMOUS_CODING(SILENT|gaC/gaT|D170|None|Vigan.08G082600.01)Vigna nepalensis
6708852CT50270.770.20DOWNSTREAM(|1332||None|Vigan.08G082700.01), SYNONYMOUS_CODING(SILENT|Ctg/Ttg|L188|None|Vigan.08G082600.01)Vigna nepalensis
6708853TA50270.770.20DOWNSTREAM(|1331||None|Vigan.08G082700.01), NON_SYNONYMOUS_CODING(MISSENSE|cTg/cAg|L188Q|None|Vigan.08G082600.01)Vigna nepalensis
6708873CT54218.770.19DOWNSTREAM(|1311||None|Vigan.08G082700.01), STOP_GAINED(NONSENSE|Cag/Tag|Q195*|None|Vigan.08G082600.01)Vigna nepalensis
6708878GA49180.770.16DOWNSTREAM(|1306||None|Vigan.08G082700.01), SYNONYMOUS_CODING(SILENT|caG/caA|Q196|None|Vigan.08G082600.01)Vigna nepalensis
6708948CA471043.740.91DOWNSTREAM(|1236||None|Vigan.08G082700.01), INTRON(|||None|Vigan.08G082600.01)Vigna nepalensis

Indels

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
6707265TTTTA472241.731.00DOWNSTREAM(|2918||None|Vigan.08G082700.01), INTRON(|||None|Vigan.08G082600.01)Vigna nepalensis
6708516AATCAGAGAACCTGCTTCTGTAT10412.741.00DOWNSTREAM(|1667||None|Vigan.08G082700.01), INTRON(|||None|Vigan.08G082600.01)Vigna nepalensis