Variant information

Chr08:21887663 - 21898446

Filter



 [SNPs] [Indels]

SNPs

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
21887741TC532083.771.00UTR_5_PRIME(|70||None|Vigan.08G233300.01)Vigna nepalensis
21887948CT431569.770.98SYNONYMOUS_CODING(SILENT|cgC/cgT|R46|None|Vigan.08G233300.01)Vigna nepalensis
21888200GT471821.771.00INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21888478AG491919.771.00NON_SYNONYMOUS_CODING(MISSENSE|Act/Gct|T161A|None|Vigan.08G233300.01)Vigna nepalensis
21888963TG482007.771.00INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21889200GA471955.771.00SYNONYMOUS_CODING(SILENT|aaG/aaA|K237|None|Vigan.08G233300.01)Vigna nepalensis
21889644AC502062.771.00INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21890026TA632575.771.00INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21891151TC391616.771.00INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21891219GA411797.771.00INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21891237CT401751.771.00INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21892133GA552235.771.00INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21892281GA441784.771.00INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21892325TC281135.771.00INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21892721CT611996.770.90INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21892845GA602495.771.00INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21892955TA552260.771.00INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21893043CT572232.771.00INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21893168CA441792.771.00INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21893195TC451792.771.00INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21893466GA562281.771.00INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21893496GA562168.771.00INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21893639CT461754.771.00INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21893786TC612371.771.00INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21893918CT511978.771.00INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21894025AT552236.771.00INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21894336AG552253.771.00NON_SYNONYMOUS_CODING(MISSENSE|Atc/Gtc|I317V|None|Vigan.08G233300.01)Vigna nepalensis
21895107TC361478.771.00DOWNSTREAM(|4767||None|Vigan.08G233400.01), INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21895986GA441735.771.00DOWNSTREAM(|3888||None|Vigan.08G233400.01), INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21896169TC532091.771.00DOWNSTREAM(|3705||None|Vigan.08G233400.01), INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21896719GA642547.771.00DOWNSTREAM(|3155||None|Vigan.08G233400.01), INTRON(|||None|Vigan.08G233300.01), SPLICE_SITE_REGION(|||None|Vigan.08G233300.01)Vigna nepalensis
21896811TC642576.771.00DOWNSTREAM(|3063||None|Vigan.08G233400.01), SYNONYMOUS_CODING(SILENT|tcT/tcC|S588|None|Vigan.08G233300.01)Vigna nepalensis
21897125AT431707.771.00DOWNSTREAM(|2749||None|Vigan.08G233400.01), SYNONYMOUS_CODING(SILENT|ctA/ctT|L646|None|Vigan.08G233300.01)Vigna nepalensis
21897845AC632593.771.00DOWNSTREAM(|2029||None|Vigan.08G233400.01), INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21897919AG592375.771.00DOWNSTREAM(|1955||None|Vigan.08G233400.01), INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21898008GA672659.771.00DOWNSTREAM(|1866||None|Vigan.08G233400.01), UTR_3_PRIME(|50||None|Vigan.08G233300.01)Vigna nepalensis
21898137CT532133.771.00DOWNSTREAM(|1737||None|Vigan.08G233400.01), UTR_3_PRIME(|179||None|Vigan.08G233300.01)Vigna nepalensis
21898192CG451775.771.00DOWNSTREAM(|1682||None|Vigan.08G233400.01), UTR_3_PRIME(|234||None|Vigan.08G233300.01)Vigna nepalensis
21898328TG522076.771.00DOWNSTREAM(|1546||None|Vigan.08G233400.01), UTR_3_PRIME(|370||None|Vigan.08G233300.01)Vigna nepalensis

Indels

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
21889774AATC522354.731.00INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21889948ATGA441030.730.93INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21890048TTA722294.731.00INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21890387AATAT371640.731.00INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21890607GAG491344.731.00INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21892386AAGGCCCTGTTCTTTTGAGTGGATTTGAGAG12285.730.67INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21892747TAT621770.730.90INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21894393ATA471396.731.00INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21895000GTTTG14302.730.79DOWNSTREAM(|4873||None|Vigan.08G233400.01), INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21895837AATATTGGTGAGA512224.731.00DOWNSTREAM(|4036||None|Vigan.08G233400.01), INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21897771CCTTC522263.731.00DOWNSTREAM(|2102||None|Vigan.08G233400.01), INTRON(|||None|Vigan.08G233300.01)Vigna nepalensis
21898035CGCAGGAGGACAAC652861.731.00DOWNSTREAM(|1838||None|Vigan.08G233400.01), UTR_3_PRIME(|78||None|Vigan.08G233300.01)Vigna nepalensis