Variant information

Chr08:13446107 - 13448440

Filter



 [SNPs] [Indels]

SNPs

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
13447171TC471921.771.00DOWNSTREAM(|4279||None|Vigan.08G151200.01), INTRON(|||None|Vigan.08G151300.01)Vigna nepalensis
13447268GT542456.771.00DOWNSTREAM(|4376||None|Vigan.08G151200.01), NON_SYNONYMOUS_CODING(MISSENSE|Gtg/Ttg|V246L|None|Vigan.08G151300.01)Vigna nepalensis
13447271GT552494.771.00DOWNSTREAM(|4379||None|Vigan.08G151200.01), NON_SYNONYMOUS_CODING(MISSENSE|Gct/Tct|A247S|None|Vigan.08G151300.01)Vigna nepalensis
13447423TC532086.771.00DOWNSTREAM(|4531||None|Vigan.08G151200.01), INTRON(|||None|Vigan.08G151300.01)Vigna nepalensis
13447547GT361505.771.00DOWNSTREAM(|4655||None|Vigan.08G151200.01), NON_SYNONYMOUS_CODING(MISSENSE|Gca/Tca|A311S|None|Vigan.08G151300.01)Vigna nepalensis
13447767CA532176.771.00DOWNSTREAM(|4875||None|Vigan.08G151200.01), NON_SYNONYMOUS_CODING(MISSENSE|Cta/Ata|L359I|None|Vigan.08G151300.01)Vigna nepalensis
13448070TC542361.771.00SYNONYMOUS_CODING(SILENT|Ttg/Ctg|L460|None|Vigan.08G151300.01)Vigna nepalensis
13448076AG582569.771.00NON_SYNONYMOUS_CODING(MISSENSE|Aat/Gat|N462D|None|Vigan.08G151300.01)Vigna nepalensis
13448119CA602346.771.00NON_SYNONYMOUS_CODING(MISSENSE|cCa/cAa|P476Q|None|Vigan.08G151300.01)Vigna nepalensis
13448212TA491908.771.00UTR_3_PRIME(|26||None|Vigan.08G151300.01)Vigna nepalensis

Indels

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
13446120GTG441369.731.00DOWNSTREAM(|3229||None|Vigan.08G151200.01), UTR_5_PRIME(|123||None|Vigan.08G151300.01)Vigna nepalensis
13446794GTG481613.731.00DOWNSTREAM(|3903||None|Vigan.08G151200.01), INTRON(|||None|Vigan.08G151300.01)Vigna nepalensis
13448369CCCACTTTCATAAGCATCAT362160.731.00UTR_3_PRIME(|184||None|Vigan.08G151300.01)Vigna nepalensis