Variant information

Chr07:7226600 - 7230822

Filter



 [SNPs] [Indels]

SNPs

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
7226856TG291310.771.00UTR_5_PRIME(|462||None|Vigan.07G085800.01)Vigna nepalensis
7226865AT291268.771.00UTR_5_PRIME(|453||None|Vigan.07G085800.01)Vigna nepalensis
7227019CT482196.771.00UTR_5_PRIME(|299||None|Vigan.07G085800.01)Vigna nepalensis
7227022AC482102.771.00UTR_5_PRIME(|296||None|Vigan.07G085800.01)Vigna nepalensis
7227139AC491940.771.00UTR_5_PRIME(|179||None|Vigan.07G085800.01)Vigna nepalensis
7227202GT371412.771.00UTR_5_PRIME(|116||None|Vigan.07G085800.01)Vigna nepalensis
7227551GT391569.771.00INTRON(|||None|Vigan.07G085800.01)Vigna nepalensis
7228128CT512032.771.00INTRON(|||None|Vigan.07G085800.01)Vigna nepalensis
7228143CT552169.771.00INTRON(|||None|Vigan.07G085800.01)Vigna nepalensis
7228530AT361397.771.00INTRON(|||None|Vigan.07G085800.01)Vigna nepalensis
7228817AT522071.771.00INTRON(|||None|Vigan.07G085800.01)Vigna nepalensis
7229183AG562198.771.00DOWNSTREAM(|4766||None|Vigan.07G085900.01), INTRON(|||None|Vigan.07G085800.01)Vigna nepalensis
7229461GA582292.771.00DOWNSTREAM(|4488||None|Vigan.07G085900.01), INTRON(|||None|Vigan.07G085800.01)Vigna nepalensis
7229654AG511929.771.00DOWNSTREAM(|4295||None|Vigan.07G085900.01), INTRON(|||None|Vigan.07G085800.01), SPLICE_SITE_REGION(|||None|Vigan.07G085800.01)Vigna nepalensis
7230041CT491835.770.98DOWNSTREAM(|3908||None|Vigan.07G085900.01), INTRON(|||None|Vigan.07G085800.01)Vigna nepalensis
7230228GT662949.771.00DOWNSTREAM(|3721||None|Vigan.07G085900.01), INTRON(|||None|Vigan.07G085800.01)Vigna nepalensis
7230655AG471868.771.00DOWNSTREAM(|3294||None|Vigan.07G085900.01), UTR_3_PRIME(|42||None|Vigan.07G085800.01)Vigna nepalensis

Indels

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
7226611TAATTTTTAAAAAGTATAGGTAGATCTTTATTCCCAAATTAGAAATTGTAACCTCTCAAACCGCT421850.731.00UTR_5_PRIME(|644||None|Vigan.07G085800.01)Vigna nepalensis
7228194AAGTTTGCTCAACAGTGCAG573100.731.00INTRON(|||None|Vigan.07G085800.01)Vigna nepalensis
7228423TAT572237.731.00INTRON(|||None|Vigan.07G085800.01), SPLICE_SITE_REGION(|||None|Vigan.07G085800.01)Vigna nepalensis
7230224AGA652903.731.00DOWNSTREAM(|3724||None|Vigan.07G085900.01), INTRON(|||None|Vigan.07G085800.01)Vigna nepalensis