Variant information

Chr07:1177135 - 1181610

Filter



 [SNPs] [Indels]

SNPs

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
1177645AG68952.770.46DOWNSTREAM(|2089||None|Vigan.07G017800.01), INTRON(|||None|Vigan.07G017700.01), UPSTREAM(|3202||None|Vigan.07G017600.01)Vigna nepalensis
1177722CT591043.770.53DOWNSTREAM(|2012||None|Vigan.07G017800.01), INTRON(|||None|Vigan.07G017700.01), UPSTREAM(|3279||None|Vigan.07G017600.01)Vigna nepalensis
1177800TA46630.770.39DOWNSTREAM(|1934||None|Vigan.07G017800.01), INTRON(|||None|Vigan.07G017700.01), UPSTREAM(|3357||None|Vigan.07G017600.01)Vigna nepalensis
1177851AT46793.770.43DOWNSTREAM(|1883||None|Vigan.07G017800.01), INTRON(|||None|Vigan.07G017700.01), UPSTREAM(|3408||None|Vigan.07G017600.01)Vigna nepalensis
1177867GT48727.770.42DOWNSTREAM(|1867||None|Vigan.07G017800.01), INTRON(|||None|Vigan.07G017700.01), UPSTREAM(|3424||None|Vigan.07G017600.01)Vigna nepalensis
1177875AG50837.770.46DOWNSTREAM(|1859||None|Vigan.07G017800.01), INTRON(|||None|Vigan.07G017700.01), UPSTREAM(|3432||None|Vigan.07G017600.01)Vigna nepalensis
1177924TA46925.770.54DOWNSTREAM(|1810||None|Vigan.07G017800.01), INTRON(|||None|Vigan.07G017700.01), UPSTREAM(|3481||None|Vigan.07G017600.01)Vigna nepalensis
1177974CT45945.770.62DOWNSTREAM(|1760||None|Vigan.07G017800.01), SYNONYMOUS_CODING(SILENT|tcC/tcT|S78|None|Vigan.07G017700.01), UPSTREAM(|3531||None|Vigan.07G017600.01)Vigna nepalensis
1178382GA60842.770.45DOWNSTREAM(|1352||None|Vigan.07G017800.01), INTRON(|||None|Vigan.07G017700.01), UPSTREAM(|3939||None|Vigan.07G017600.01)Vigna nepalensis
1178385TA612568.771.00DOWNSTREAM(|1349||None|Vigan.07G017800.01), INTRON(|||None|Vigan.07G017700.01), UPSTREAM(|3942||None|Vigan.07G017600.01)Vigna nepalensis
1178570CA581114.770.55DOWNSTREAM(|1164||None|Vigan.07G017800.01), INTRON(|||None|Vigan.07G017700.01), UPSTREAM(|4127||None|Vigan.07G017600.01)Vigna nepalensis
1179404CA471846.771.00DOWNSTREAM(|330||None|Vigan.07G017800.01), DOWNSTREAM(|4623||None|Vigan.07G017900.01), SYNONYMOUS_CODING(SILENT|gtC/gtA|V305|None|Vigan.07G017700.01), UPSTREAM(|4961||None|Vigan.07G017600.01)Vigna nepalensis
1179901GT702710.771.00DOWNSTREAM(|4126||None|Vigan.07G017900.01), INTRON(|||None|Vigan.07G017700.01), UTR_3_PRIME(|88||None|Vigan.07G017800.01)Vigna nepalensis
1180046AG56863.770.45DOWNSTREAM(|3981||None|Vigan.07G017900.01), SYNONYMOUS_CODING(SILENT|ccA/ccG|P365|None|Vigan.07G017700.01), SYNONYMOUS_CODING(SILENT|ttT/ttC|F81|None|Vigan.07G017800.01)Vigna nepalensis
1180299AC631042.770.49DOWNSTREAM(|3728||None|Vigan.07G017900.01), INTRON(|||None|Vigan.07G017700.01), UTR_5_PRIME(|11||None|Vigan.07G017800.01)Vigna nepalensis
1180359GC611163.770.54DOWNSTREAM(|3668||None|Vigan.07G017900.01), SYNONYMOUS_CODING(SILENT|cgG/cgC|R398|None|Vigan.07G017700.01), UTR_5_PRIME(|71||None|Vigan.07G017800.01)Vigna nepalensis
1180467CG58942.770.50DOWNSTREAM(|3560||None|Vigan.07G017900.01), SYNONYMOUS_CODING(SILENT|ccC/ccG|P434|None|Vigan.07G017700.01), UTR_5_PRIME(|179||None|Vigan.07G017800.01)Vigna nepalensis
1181309GT542180.771.00DOWNSTREAM(|2718||None|Vigan.07G017900.01), UTR_3_PRIME(|827||None|Vigan.07G017700.01), UTR_5_PRIME(|1021||None|Vigan.07G017800.01)Vigna nepalensis
1181527AG491838.770.98DOWNSTREAM(|2500||None|Vigan.07G017900.01), UTR_3_PRIME(|1045||None|Vigan.07G017700.01), UTR_5_PRIME(|1239||None|Vigan.07G017800.01)Vigna nepalensis
1181596CT46947.770.52DOWNSTREAM(|2431||None|Vigan.07G017900.01), UTR_3_PRIME(|1114||None|Vigan.07G017700.01), UTR_5_PRIME(|1308||None|Vigan.07G017800.01)Vigna nepalensis
1181609CT471024.770.55DOWNSTREAM(|2418||None|Vigan.07G017900.01), START_GAINED(|||None|Vigan.07G017800.01), UTR_3_PRIME(|1127||None|Vigan.07G017700.01), UTR_5_PRIME(|1321||None|Vigan.07G017800.01)Vigna nepalensis

Indels

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
1177796TCAT43618.730.40DOWNSTREAM(|1937||None|Vigan.07G017800.01), INTRON(|||None|Vigan.07G017700.01), UPSTREAM(|3354||None|Vigan.07G017600.01)Vigna nepalensis
1177798AATT40722.730.57DOWNSTREAM(|1935||None|Vigan.07G017800.01), INTRON(|||None|Vigan.07G017700.01), UPSTREAM(|3356||None|Vigan.07G017600.01)Vigna nepalensis
1178441TGGCTTTAGTTTCTAGTTAT701316.730.51DOWNSTREAM(|1292||None|Vigan.07G017800.01), INTRON(|||None|Vigan.07G017700.01), UPSTREAM(|3999||None|Vigan.07G017600.01)Vigna nepalensis
1179722ATGGATGAATGTA552397.731.00DOWNSTREAM(|11||None|Vigan.07G017800.01), DOWNSTREAM(|4304||None|Vigan.07G017900.01), INTRON(|||None|Vigan.07G017700.01), SPLICE_SITE_REGION(|||None|Vigan.07G017700.01)Vigna nepalensis