Variant information

Chr06:29379389 - 29386562

Filter



 [SNPs] [Indels]

SNPs

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
29379716AG441621.771.00INTRON(|||None|Vigan.06G160900.01), UPSTREAM(|3614||None|Vigan.06G160800.01), UPSTREAM(|787||None|Vigan.06G160700.01)Vigna nepalensis
29379852TC622391.771.00SYNONYMOUS_CODING(SILENT|ttT/ttC|F72|None|Vigan.06G160900.01), UPSTREAM(|3478||None|Vigan.06G160800.01), UPSTREAM(|923||None|Vigan.06G160700.01)Vigna nepalensis
29380433GA492013.771.00INTRON(|||None|Vigan.06G160900.01), UPSTREAM(|1504||None|Vigan.06G160700.01), UPSTREAM(|2897||None|Vigan.06G160800.01)Vigna nepalensis
29380767CT502090.771.00INTRON(|||None|Vigan.06G160900.01), UPSTREAM(|1838||None|Vigan.06G160700.01), UPSTREAM(|2563||None|Vigan.06G160800.01)Vigna nepalensis
29380911AT522181.771.00INTRON(|||None|Vigan.06G160900.01), UPSTREAM(|1982||None|Vigan.06G160700.01), UPSTREAM(|2419||None|Vigan.06G160800.01)Vigna nepalensis
29381036AT873182.771.00INTRON(|||None|Vigan.06G160900.01), UPSTREAM(|2107||None|Vigan.06G160700.01), UPSTREAM(|2294||None|Vigan.06G160800.01)Vigna nepalensis
29381183AC582257.771.00INTRON(|||None|Vigan.06G160900.01), UPSTREAM(|2147||None|Vigan.06G160800.01), UPSTREAM(|2254||None|Vigan.06G160700.01)Vigna nepalensis
29381468GA542236.771.00INTRON(|||None|Vigan.06G160900.01), UPSTREAM(|1862||None|Vigan.06G160800.01), UPSTREAM(|2539||None|Vigan.06G160700.01)Vigna nepalensis
29382082AC481884.771.00INTRON(|||None|Vigan.06G160900.01), UPSTREAM(|1248||None|Vigan.06G160800.01), UPSTREAM(|3153||None|Vigan.06G160700.01)Vigna nepalensis
29382563CG592304.771.00DOWNSTREAM(|4626||None|Vigan.06G161000.01), INTRON(|||None|Vigan.06G160900.01), UPSTREAM(|3634||None|Vigan.06G160700.01), UPSTREAM(|767||None|Vigan.06G160800.01)Vigna nepalensis
29383079CT652544.771.00DOWNSTREAM(|4110||None|Vigan.06G161000.01), INTRON(|||None|Vigan.06G160900.01), UPSTREAM(|251||None|Vigan.06G160800.01), UPSTREAM(|4150||None|Vigan.06G160700.01)Vigna nepalensis
29383117AG522267.771.00DOWNSTREAM(|4072||None|Vigan.06G161000.01), INTRON(|||None|Vigan.06G160900.01), UPSTREAM(|213||None|Vigan.06G160800.01), UPSTREAM(|4188||None|Vigan.06G160700.01)Vigna nepalensis
29383125GA552582.771.00DOWNSTREAM(|4064||None|Vigan.06G161000.01), INTRON(|||None|Vigan.06G160900.01), UPSTREAM(|205||None|Vigan.06G160800.01), UPSTREAM(|4196||None|Vigan.06G160700.01)Vigna nepalensis
29383127GA542545.771.00DOWNSTREAM(|4062||None|Vigan.06G161000.01), INTRON(|||None|Vigan.06G160900.01), UPSTREAM(|203||None|Vigan.06G160800.01), UPSTREAM(|4198||None|Vigan.06G160700.01)Vigna nepalensis
29383193CT502038.771.00DOWNSTREAM(|3996||None|Vigan.06G161000.01), INTRON(|||None|Vigan.06G160900.01), UPSTREAM(|137||None|Vigan.06G160800.01), UPSTREAM(|4264||None|Vigan.06G160700.01)Vigna nepalensis
29383269CT411767.771.00DOWNSTREAM(|3920||None|Vigan.06G161000.01), INTRON(|||None|Vigan.06G160900.01), UPSTREAM(|4340||None|Vigan.06G160700.01), UPSTREAM(|61||None|Vigan.06G160800.01)Vigna nepalensis
29383288GA361610.771.00DOWNSTREAM(|3901||None|Vigan.06G161000.01), INTRON(|||None|Vigan.06G160900.01), UPSTREAM(|42||None|Vigan.06G160800.01), UPSTREAM(|4359||None|Vigan.06G160700.01)Vigna nepalensis
29383419AG23827.771.00DOWNSTREAM(|3770||None|Vigan.06G161000.01), EXON(|||None|Vigan.06G160800.01), INTRON(|||None|Vigan.06G160900.01), UPSTREAM(|4490||None|Vigan.06G160700.01)Vigna nepalensis
29384092AT511976.771.00DOWNSTREAM(|139||None|Vigan.06G160800.01), DOWNSTREAM(|3097||None|Vigan.06G161000.01), INTRON(|||None|Vigan.06G160900.01)Vigna nepalensis
29384694AG562225.771.00DOWNSTREAM(|2495||None|Vigan.06G161000.01), DOWNSTREAM(|741||None|Vigan.06G160800.01), INTRON(|||None|Vigan.06G160900.01)Vigna nepalensis
29384741TG642447.771.00DOWNSTREAM(|2448||None|Vigan.06G161000.01), DOWNSTREAM(|788||None|Vigan.06G160800.01), INTRON(|||None|Vigan.06G160900.01)Vigna nepalensis
29384960CT632696.771.00DOWNSTREAM(|1007||None|Vigan.06G160800.01), DOWNSTREAM(|2229||None|Vigan.06G161000.01), INTRON(|||None|Vigan.06G160900.01)Vigna nepalensis
29385082AG763065.771.00DOWNSTREAM(|1129||None|Vigan.06G160800.01), DOWNSTREAM(|2107||None|Vigan.06G161000.01), INTRON(|||None|Vigan.06G160900.01)Vigna nepalensis
29385117CT662431.771.00DOWNSTREAM(|1164||None|Vigan.06G160800.01), DOWNSTREAM(|2072||None|Vigan.06G161000.01), INTRON(|||None|Vigan.06G160900.01)Vigna nepalensis
29385720CT552189.771.00DOWNSTREAM(|1469||None|Vigan.06G161000.01), DOWNSTREAM(|1767||None|Vigan.06G160800.01), INTRON(|||None|Vigan.06G160900.01)Vigna nepalensis
29386005TA592383.771.00DOWNSTREAM(|1184||None|Vigan.06G161000.01), DOWNSTREAM(|2052||None|Vigan.06G160800.01), INTRON(|||None|Vigan.06G160900.01)Vigna nepalensis
29386038GA742917.771.00DOWNSTREAM(|1151||None|Vigan.06G161000.01), DOWNSTREAM(|2085||None|Vigan.06G160800.01), INTRON(|||None|Vigan.06G160900.01)Vigna nepalensis
29386144CA612759.771.00DOWNSTREAM(|1045||None|Vigan.06G161000.01), DOWNSTREAM(|2191||None|Vigan.06G160800.01), INTRON(|||None|Vigan.06G160900.01)Vigna nepalensis
29386151AT612728.771.00DOWNSTREAM(|1038||None|Vigan.06G161000.01), DOWNSTREAM(|2198||None|Vigan.06G160800.01), SYNONYMOUS_CODING(SILENT|ctA/ctT|L302|None|Vigan.06G160900.01)Vigna nepalensis
29386270CA552168.771.00DOWNSTREAM(|2317||None|Vigan.06G160800.01), DOWNSTREAM(|919||None|Vigan.06G161000.01), STOP_GAINED(NONSENSE|tCa/tAa|S342*|None|Vigan.06G160900.01)Vigna nepalensis
29386286CA542495.771.00DOWNSTREAM(|2333||None|Vigan.06G160800.01), DOWNSTREAM(|903||None|Vigan.06G161000.01), NON_SYNONYMOUS_CODING(MISSENSE|gaC/gaA|D347E|None|Vigan.06G160900.01)Vigna nepalensis
29386292CG582596.771.00DOWNSTREAM(|2339||None|Vigan.06G160800.01), DOWNSTREAM(|897||None|Vigan.06G161000.01), SYNONYMOUS_CODING(SILENT|acC/acG|T349|None|Vigan.06G160900.01)Vigna nepalensis
29386336AC592299.771.00DOWNSTREAM(|2383||None|Vigan.06G160800.01), DOWNSTREAM(|853||None|Vigan.06G161000.01), UTR_3_PRIME(|38||None|Vigan.06G160900.01)Vigna nepalensis

Indels

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
29380116TTA501675.731.00INTRON(|||None|Vigan.06G160900.01), UPSTREAM(|1188||None|Vigan.06G160700.01), UPSTREAM(|3213||None|Vigan.06G160800.01)Vigna nepalensis
29380984CCT622206.731.00INTRON(|||None|Vigan.06G160900.01), UPSTREAM(|2056||None|Vigan.06G160700.01), UPSTREAM(|2345||None|Vigan.06G160800.01)Vigna nepalensis
29381840CAC481403.731.00INTRON(|||None|Vigan.06G160900.01), UPSTREAM(|1489||None|Vigan.06G160800.01), UPSTREAM(|2912||None|Vigan.06G160700.01)Vigna nepalensis
29382435CAAC612673.731.00DOWNSTREAM(|4753||None|Vigan.06G161000.01), INTRON(|||None|Vigan.06G160900.01), UPSTREAM(|3507||None|Vigan.06G160700.01), UPSTREAM(|894||None|Vigan.06G160800.01)Vigna nepalensis
29384724TTAGAGAAGAGCGTTTAAAG593272.731.00DOWNSTREAM(|2464||None|Vigan.06G161000.01), DOWNSTREAM(|772||None|Vigan.06G160800.01), INTRON(|||None|Vigan.06G160900.01)Vigna nepalensis