Variant information

Chr06:27546895 - 27549660

Filter



 [SNPs] [Indels]

SNPs

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
27547757TA351346.771.00DOWNSTREAM(|3935||None|Vigan.06G147200.01), INTRON(|||None|Vigan.06G147100.01), SPLICE_SITE_REGION(|||None|Vigan.06G147100.01)Vigna nepalensis
27547896CT9320.781.00DOWNSTREAM(|3796||None|Vigan.06G147200.01), INTRON(|||None|Vigan.06G147100.01)Vigna nepalensis
27548108TC6175.841.00DOWNSTREAM(|3584||None|Vigan.06G147200.01), NON_SYNONYMOUS_CODING(MISSENSE|Ttt/Ctt|F242L|None|Vigan.06G147100.01)Vigna nepalensis
27548378CT23715.771.00DOWNSTREAM(|3314||None|Vigan.06G147200.01), INTRON(|||None|Vigan.06G147100.01)Vigna nepalensis
27548446AG21663.771.00DOWNSTREAM(|3246||None|Vigan.06G147200.01), INTRON(|||None|Vigan.06G147100.01)Vigna nepalensis
27548904CA5226.841.00DOWNSTREAM(|2788||None|Vigan.06G147200.01), INTRON(|||None|Vigan.06G147100.01)Vigna nepalensis
27548906CT6226.841.00DOWNSTREAM(|2786||None|Vigan.06G147200.01), INTRON(|||None|Vigan.06G147100.01)Vigna nepalensis
27549427AG11466.771.00DOWNSTREAM(|2265||None|Vigan.06G147200.01), UTR_3_PRIME(|27||None|Vigan.06G147100.01)Vigna nepalensis
27549453TG14593.771.00DOWNSTREAM(|2239||None|Vigan.06G147200.01), UTR_3_PRIME(|53||None|Vigan.06G147100.01)Vigna nepalensis
27549496CG11497.771.00DOWNSTREAM(|2196||None|Vigan.06G147200.01), UTR_3_PRIME(|96||None|Vigan.06G147100.01)Vigna nepalensis
27549524TC10466.771.00DOWNSTREAM(|2168||None|Vigan.06G147200.01), UTR_3_PRIME(|124||None|Vigan.06G147100.01)Vigna nepalensis
27549545AC14601.771.00DOWNSTREAM(|2147||None|Vigan.06G147200.01), UTR_3_PRIME(|145||None|Vigan.06G147100.01)Vigna nepalensis
27549546GA14646.771.00DOWNSTREAM(|2146||None|Vigan.06G147200.01), UTR_3_PRIME(|146||None|Vigan.06G147100.01)Vigna nepalensis
27549607CT481700.771.00DOWNSTREAM(|2085||None|Vigan.06G147200.01), UTR_3_PRIME(|207||None|Vigan.06G147100.01)Vigna nepalensis
27549642TG431940.771.00DOWNSTREAM(|2050||None|Vigan.06G147200.01), UTR_3_PRIME(|242||None|Vigan.06G147100.01)Vigna nepalensis

Indels

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
27547366AAT521457.731.00DOWNSTREAM(|4325||None|Vigan.06G147200.01), INTRON(|||None|Vigan.06G147100.01)Vigna nepalensis
27549435GTG11501.731.00DOWNSTREAM(|2256||None|Vigan.06G147200.01), UTR_3_PRIME(|36||None|Vigan.06G147100.01)Vigna nepalensis
27549498ATA12533.731.00DOWNSTREAM(|2193||None|Vigan.06G147200.01), UTR_3_PRIME(|99||None|Vigan.06G147100.01)Vigna nepalensis
27549500ATA12533.731.00DOWNSTREAM(|2191||None|Vigan.06G147200.01), UTR_3_PRIME(|101||None|Vigan.06G147100.01)Vigna nepalensis
27549563CCTATATAT181402.731.00DOWNSTREAM(|2128||None|Vigan.06G147200.01), UTR_3_PRIME(|164||None|Vigan.06G147100.01)Vigna nepalensis
27549564CCTTGTAAAAATGTTTGTAAGAACTTGT231402.731.00DOWNSTREAM(|2127||None|Vigan.06G147200.01), UTR_3_PRIME(|165||None|Vigan.06G147100.01)Vigna nepalensis
27549653CCA462027.731.00DOWNSTREAM(|2038||None|Vigan.06G147200.01), UTR_3_PRIME(|254||None|Vigan.06G147100.01)Vigna nepalensis