Variant information

Chr05:2673130 - 2675394

Filter



 [SNPs] [Indels]

SNPs

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
2673156GC271178.771.00UTR_5_PRIME(|184||None|Vigan.05G040100.01)Vigna nepalensis
2673201CT361636.771.00UTR_5_PRIME(|139||None|Vigan.05G040100.01)Vigna nepalensis
2673211AC351591.771.00UTR_5_PRIME(|129||None|Vigan.05G040100.01)Vigna nepalensis
2673218CT331501.771.00UTR_5_PRIME(|122||None|Vigan.05G040100.01)Vigna nepalensis
2673232GA361591.771.00UTR_5_PRIME(|108||None|Vigan.05G040100.01)Vigna nepalensis
2673234TC361591.771.00UTR_5_PRIME(|106||None|Vigan.05G040100.01)Vigna nepalensis
2673322CG502171.771.00START_GAINED(|||None|Vigan.05G040100.01), UTR_5_PRIME(|18||None|Vigan.05G040100.01)Vigna nepalensis
2673331TC472179.771.00UTR_5_PRIME(|9||None|Vigan.05G040100.01)Vigna nepalensis
2673667AG381697.771.00DOWNSTREAM(|4880||None|Vigan.05G040200.01), NON_SYNONYMOUS_CODING(MISSENSE|Acc/Gcc|T110A|None|Vigan.05G040100.01)Vigna nepalensis
2673673TC381661.771.00DOWNSTREAM(|4874||None|Vigan.05G040200.01), NON_SYNONYMOUS_CODING(MISSENSE|Tct/Cct|S112P|None|Vigan.05G040100.01)Vigna nepalensis
2673759CG472086.771.00DOWNSTREAM(|4788||None|Vigan.05G040200.01), INTRON(|||None|Vigan.05G040100.01)Vigna nepalensis
2673760TG472086.771.00DOWNSTREAM(|4787||None|Vigan.05G040200.01), INTRON(|||None|Vigan.05G040100.01)Vigna nepalensis
2673776GA462131.771.00DOWNSTREAM(|4771||None|Vigan.05G040200.01), INTRON(|||None|Vigan.05G040100.01)Vigna nepalensis
2673797CT472003.771.00DOWNSTREAM(|4750||None|Vigan.05G040200.01), INTRON(|||None|Vigan.05G040100.01)Vigna nepalensis
2673965CT793459.771.00DOWNSTREAM(|4582||None|Vigan.05G040200.01), INTRON(|||None|Vigan.05G040100.01)Vigna nepalensis
2673975CT753377.771.00DOWNSTREAM(|4572||None|Vigan.05G040200.01), INTRON(|||None|Vigan.05G040100.01)Vigna nepalensis
2674008TA833685.771.00DOWNSTREAM(|4539||None|Vigan.05G040200.01), INTRON(|||None|Vigan.05G040100.01)Vigna nepalensis
2674012GA833696.771.00DOWNSTREAM(|4535||None|Vigan.05G040200.01), INTRON(|||None|Vigan.05G040100.01)Vigna nepalensis
2674072AG662574.771.00DOWNSTREAM(|4475||None|Vigan.05G040200.01), INTRON(|||None|Vigan.05G040100.01)Vigna nepalensis
2674181GA512289.771.00DOWNSTREAM(|4366||None|Vigan.05G040200.01), INTRON(|||None|Vigan.05G040100.01)Vigna nepalensis
2674189CG552437.771.00DOWNSTREAM(|4358||None|Vigan.05G040200.01), INTRON(|||None|Vigan.05G040100.01)Vigna nepalensis
2674245GA552201.771.00DOWNSTREAM(|4302||None|Vigan.05G040200.01), INTRON(|||None|Vigan.05G040100.01)Vigna nepalensis
2674427GA431870.771.00DOWNSTREAM(|4120||None|Vigan.05G040200.01), SYNONYMOUS_CODING(SILENT|cgG/cgA|R171|None|Vigan.05G040100.01)Vigna nepalensis
2674430TC411895.771.00DOWNSTREAM(|4117||None|Vigan.05G040200.01), SYNONYMOUS_CODING(SILENT|taT/taC|Y172|None|Vigan.05G040100.01)Vigna nepalensis
2674489GA461746.771.00DOWNSTREAM(|4058||None|Vigan.05G040200.01), NON_SYNONYMOUS_CODING(MISSENSE|gGc/gAc|G192D|None|Vigan.05G040100.01)Vigna nepalensis
2674553CT321210.771.00DOWNSTREAM(|3994||None|Vigan.05G040200.01), SYNONYMOUS_CODING(SILENT|gaC/gaT|D213|None|Vigan.05G040100.01)Vigna nepalensis
2674565GA371302.771.00DOWNSTREAM(|3982||None|Vigan.05G040200.01), SYNONYMOUS_CODING(SILENT|ctG/ctA|L217|None|Vigan.05G040100.01)Vigna nepalensis
2674604CT431901.771.00DOWNSTREAM(|3943||None|Vigan.05G040200.01), SYNONYMOUS_CODING(SILENT|ccC/ccT|P230|None|Vigan.05G040100.01)Vigna nepalensis
2674607TC431987.771.00DOWNSTREAM(|3940||None|Vigan.05G040200.01), SYNONYMOUS_CODING(SILENT|aaT/aaC|N231|None|Vigan.05G040100.01)Vigna nepalensis
2674616CT421974.771.00DOWNSTREAM(|3931||None|Vigan.05G040200.01), SYNONYMOUS_CODING(SILENT|ttC/ttT|F234|None|Vigan.05G040100.01)Vigna nepalensis
2674682GA371636.771.00DOWNSTREAM(|3865||None|Vigan.05G040200.01), SYNONYMOUS_CODING(SILENT|acG/acA|T256|None|Vigan.05G040100.01)Vigna nepalensis
2674691CG361591.771.00DOWNSTREAM(|3856||None|Vigan.05G040200.01), SYNONYMOUS_CODING(SILENT|gcC/gcG|A259|None|Vigan.05G040100.01)Vigna nepalensis
2674697CT351591.771.00DOWNSTREAM(|3850||None|Vigan.05G040200.01), SYNONYMOUS_CODING(SILENT|gaC/gaT|D261|None|Vigan.05G040100.01)Vigna nepalensis
2674706TC361562.771.00DOWNSTREAM(|3841||None|Vigan.05G040200.01), SYNONYMOUS_CODING(SILENT|tcT/tcC|S264|None|Vigan.05G040100.01)Vigna nepalensis
2674718TC341257.771.00DOWNSTREAM(|3829||None|Vigan.05G040200.01), SYNONYMOUS_CODING(SILENT|tgT/tgC|C268|None|Vigan.05G040100.01)Vigna nepalensis
2675048GA451830.771.00DOWNSTREAM(|3499||None|Vigan.05G040200.01), SYNONYMOUS_CODING(SILENT|ttG/ttA|L378|None|Vigan.05G040100.01)Vigna nepalensis
2675074TC542444.771.00DOWNSTREAM(|3473||None|Vigan.05G040200.01), NON_SYNONYMOUS_CODING(MISSENSE|tTc/tCc|F387S|None|Vigan.05G040100.01)Vigna nepalensis
2675095GA642766.771.00DOWNSTREAM(|3452||None|Vigan.05G040200.01), UTR_3_PRIME(|11||None|Vigan.05G040100.01)Vigna nepalensis
2675124TC702593.771.00DOWNSTREAM(|3423||None|Vigan.05G040200.01), UTR_3_PRIME(|40||None|Vigan.05G040100.01)Vigna nepalensis
2675157AG642541.771.00DOWNSTREAM(|3390||None|Vigan.05G040200.01), UTR_3_PRIME(|73||None|Vigan.05G040100.01)Vigna nepalensis
2675199GC462015.771.00DOWNSTREAM(|3348||None|Vigan.05G040200.01), UTR_3_PRIME(|115||None|Vigan.05G040100.01)Vigna nepalensis
2675338TA472116.771.00DOWNSTREAM(|3209||None|Vigan.05G040200.01), UTR_3_PRIME(|254||None|Vigan.05G040100.01)Vigna nepalensis
2675340AG472116.771.00DOWNSTREAM(|3207||None|Vigan.05G040200.01), UTR_3_PRIME(|256||None|Vigan.05G040100.01)Vigna nepalensis
2675386AC441748.771.00DOWNSTREAM(|3161||None|Vigan.05G040200.01), UTR_3_PRIME(|302||None|Vigan.05G040100.01)Vigna nepalensis

Indels

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
2673767TCGT472122.731.00DOWNSTREAM(|4779||None|Vigan.05G040200.01), INTRON(|||None|Vigan.05G040100.01)Vigna nepalensis
2674137TTAT582561.731.00DOWNSTREAM(|4409||None|Vigan.05G040200.01), INTRON(|||None|Vigan.05G040100.01)Vigna nepalensis
2675082TTAAC612853.731.00CODON_INSERTION(|taa/tAACaa|*390*Q|None|Vigan.05G040100.01), DOWNSTREAM(|3464||None|Vigan.05G040200.01)Vigna nepalensis
2675200TTTATTCACAGAAAGATTGAT452006.731.00DOWNSTREAM(|3346||None|Vigan.05G040200.01), UTR_3_PRIME(|117||None|Vigan.05G040100.01)Vigna nepalensis