Variant information

Chr05:13898174 - 13899403

Filter



 [SNPs] [Indels]

SNPs

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
13898258CT562075.771.00DOWNSTREAM(|1813||None|Vigan.05G166800.01), DOWNSTREAM(|3786||None|Vigan.05G167000.01), UTR_3_PRIME(|75||None|Vigan.05G166900.01)Vigna nepalensis
13898318GA562143.771.00DOWNSTREAM(|1873||None|Vigan.05G166800.01), DOWNSTREAM(|3726||None|Vigan.05G167000.01), UTR_3_PRIME(|15||None|Vigan.05G166900.01)Vigna nepalensis
13898412GC401509.771.00DOWNSTREAM(|1967||None|Vigan.05G166800.01), DOWNSTREAM(|3632||None|Vigan.05G167000.01), NON_SYNONYMOUS_CODING(MISSENSE|aCt/aGt|T195S|None|Vigan.05G166900.01)Vigna nepalensis
13898527CA461851.771.00DOWNSTREAM(|2082||None|Vigan.05G166800.01), DOWNSTREAM(|3517||None|Vigan.05G167000.01), NON_SYNONYMOUS_CODING(MISSENSE|Gct/Tct|A157S|None|Vigan.05G166900.01)Vigna nepalensis
13898668CT612417.771.00DOWNSTREAM(|2223||None|Vigan.05G166800.01), DOWNSTREAM(|3376||None|Vigan.05G167000.01), NON_SYNONYMOUS_CODING(MISSENSE|Gct/Act|A110T|None|Vigan.05G166900.01)Vigna nepalensis
13898772AG642571.771.00DOWNSTREAM(|2327||None|Vigan.05G166800.01), DOWNSTREAM(|3272||None|Vigan.05G167000.01), INTRON(|||None|Vigan.05G166900.01)Vigna nepalensis
13898803CT572700.771.00DOWNSTREAM(|2358||None|Vigan.05G166800.01), DOWNSTREAM(|3241||None|Vigan.05G167000.01), INTRON(|||None|Vigan.05G166900.01)Vigna nepalensis
13898809GC612851.771.00DOWNSTREAM(|2364||None|Vigan.05G166800.01), DOWNSTREAM(|3235||None|Vigan.05G167000.01), INTRON(|||None|Vigan.05G166900.01)Vigna nepalensis
13898818CT683121.771.00DOWNSTREAM(|2373||None|Vigan.05G166800.01), DOWNSTREAM(|3226||None|Vigan.05G167000.01), INTRON(|||None|Vigan.05G166900.01)Vigna nepalensis
13899213CG562338.771.00DOWNSTREAM(|2768||None|Vigan.05G166800.01), DOWNSTREAM(|2831||None|Vigan.05G167000.01), SYNONYMOUS_CODING(SILENT|ctG/ctC|L44|None|Vigan.05G166900.01)Vigna nepalensis

Indels

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
13898236AAT471548.731.00DOWNSTREAM(|1792||None|Vigan.05G166800.01), DOWNSTREAM(|3807||None|Vigan.05G167000.01), UTR_3_PRIME(|96||None|Vigan.05G166900.01)Vigna nepalensis
13898828GTACATTG703202.731.00DOWNSTREAM(|2384||None|Vigan.05G166800.01), DOWNSTREAM(|3215||None|Vigan.05G167000.01), INTRON(|||None|Vigan.05G166900.01)Vigna nepalensis
13898839GTCTG703157.731.00DOWNSTREAM(|2395||None|Vigan.05G166800.01), DOWNSTREAM(|3204||None|Vigan.05G167000.01), INTRON(|||None|Vigan.05G166900.01)Vigna nepalensis
13898846TTAT663279.731.00DOWNSTREAM(|2402||None|Vigan.05G166800.01), DOWNSTREAM(|3197||None|Vigan.05G167000.01), INTRON(|||None|Vigan.05G166900.01)Vigna nepalensis
13898850TCTCATAAAACCAACTTTATAAGACGAGGTTTCTACTCACTTTAGATTGATCTTATCTCTAACCATGTAAGT683015.731.00DOWNSTREAM(|2406||None|Vigan.05G166800.01), DOWNSTREAM(|3193||None|Vigan.05G167000.01), INTRON(|||None|Vigan.05G166900.01)Vigna nepalensis