Variant information

Chr04:47566909 - 47574069

Filter



 [SNPs] [Indels]

SNPs

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
47566935AG461730.771.00DOWNSTREAM(|3452||None|Vigan.04G354500.01), START_GAINED(|||None|Vigan.04G354600.01), UTR_5_PRIME(|45||None|Vigan.04G354600.01)Vigna nepalensis
47567065GT441745.771.00DOWNSTREAM(|3582||None|Vigan.04G354500.01), INTRON(|||None|Vigan.04G354600.01)Vigna nepalensis
47567314AG501939.771.00DOWNSTREAM(|3831||None|Vigan.04G354500.01), INTRON(|||None|Vigan.04G354600.01)Vigna nepalensis
47567522GT491893.771.00DOWNSTREAM(|4039||None|Vigan.04G354500.01), INTRON(|||None|Vigan.04G354600.01)Vigna nepalensis
47568370CT501950.771.00DOWNSTREAM(|4887||None|Vigan.04G354500.01), NON_SYNONYMOUS_CODING(MISSENSE|aCc/aTc|T144I|None|Vigan.04G354600.01)Vigna nepalensis
47568733GA491921.771.00INTRON(|||None|Vigan.04G354600.01)Vigna nepalensis
47569238TC732915.771.00INTRON(|||None|Vigan.04G354600.01)Vigna nepalensis
47570242TA662566.771.00DOWNSTREAM(|4643||None|Vigan.04G354700.01), INTRON(|||None|Vigan.04G354600.01)Vigna nepalensis
47570332AC542164.771.00DOWNSTREAM(|4553||None|Vigan.04G354700.01), INTRON(|||None|Vigan.04G354600.01)Vigna nepalensis
47570487GA421606.771.00DOWNSTREAM(|4398||None|Vigan.04G354700.01), INTRON(|||None|Vigan.04G354600.01)Vigna nepalensis
47570620AC401494.771.00DOWNSTREAM(|4265||None|Vigan.04G354700.01), INTRON(|||None|Vigan.04G354600.01)Vigna nepalensis
47570834GA542228.771.00DOWNSTREAM(|4051||None|Vigan.04G354700.01), INTRON(|||None|Vigan.04G354600.01)Vigna nepalensis
47571039AT481875.771.00DOWNSTREAM(|3846||None|Vigan.04G354700.01), INTRON(|||None|Vigan.04G354600.01)Vigna nepalensis
47571117GA531882.770.96DOWNSTREAM(|3768||None|Vigan.04G354700.01), INTRON(|||None|Vigan.04G354600.01)Vigna nepalensis
47571143CT491809.770.96DOWNSTREAM(|3742||None|Vigan.04G354700.01), INTRON(|||None|Vigan.04G354600.01)Vigna nepalensis
47571188CT461726.771.00DOWNSTREAM(|3697||None|Vigan.04G354700.01), INTRON(|||None|Vigan.04G354600.01)Vigna nepalensis
47571209TC351358.771.00DOWNSTREAM(|3676||None|Vigan.04G354700.01), INTRON(|||None|Vigan.04G354600.01)Vigna nepalensis
47571870AT692885.771.00DOWNSTREAM(|3015||None|Vigan.04G354700.01), INTRON(|||None|Vigan.04G354600.01)Vigna nepalensis
47572316TC602359.771.00DOWNSTREAM(|2569||None|Vigan.04G354700.01), INTRON(|||None|Vigan.04G354600.01)Vigna nepalensis
47573847TC562306.771.00DOWNSTREAM(|1038||None|Vigan.04G354700.01), UTR_3_PRIME(|354||None|Vigan.04G354600.01)Vigna nepalensis

Indels

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
47568313ATA491433.731.00DOWNSTREAM(|4831||None|Vigan.04G354500.01), INTRON(|||None|Vigan.04G354600.01)Vigna nepalensis
47570850GACATCCTCGTCCCAATTCAACCGAAACATTTTGGCGCTGCGCGACCGATCGGTGTGTGGGGGTGACCTGTAGAATG502211.731.00DOWNSTREAM(|4034||None|Vigan.04G354700.01), INTRON(|||None|Vigan.04G354600.01)Vigna nepalensis
47570978CCGGTGAGTTAGGTCTTTAGTAATTCAAG442270.731.00DOWNSTREAM(|3906||None|Vigan.04G354700.01), INTRON(|||None|Vigan.04G354600.01)Vigna nepalensis
47572410TAT471424.731.00DOWNSTREAM(|2474||None|Vigan.04G354700.01), INTRON(|||None|Vigan.04G354600.01)Vigna nepalensis
47573675TTATTTTATTGT431883.731.00DOWNSTREAM(|1209||None|Vigan.04G354700.01), UTR_3_PRIME(|183||None|Vigan.04G354600.01)Vigna nepalensis