Variant information

Chr04:47069588 - 47072655

Filter



 [SNPs] [Indels]

SNPs

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
47069700CA401595.771.00DOWNSTREAM(|1148||None|Vigan.04G348700.01), UPSTREAM(|2533||None|Vigan.04G348900.01), UTR_3_PRIME(|222||None|Vigan.04G348800.01)Vigna nepalensis
47070201AG662550.771.00DOWNSTREAM(|1649||None|Vigan.04G348700.01), INTRON(|||None|Vigan.04G348800.01), UPSTREAM(|2032||None|Vigan.04G348900.01)Vigna nepalensis
47070857GT522368.771.00DOWNSTREAM(|2305||None|Vigan.04G348700.01), INTRON(|||None|Vigan.04G348800.01), UPSTREAM(|1376||None|Vigan.04G348900.01)Vigna nepalensis
47070859AT522504.771.00DOWNSTREAM(|2307||None|Vigan.04G348700.01), INTRON(|||None|Vigan.04G348800.01), UPSTREAM(|1374||None|Vigan.04G348900.01)Vigna nepalensis
47070860CT542570.771.00DOWNSTREAM(|2308||None|Vigan.04G348700.01), INTRON(|||None|Vigan.04G348800.01), UPSTREAM(|1373||None|Vigan.04G348900.01)Vigna nepalensis
47071266CA311284.771.00DOWNSTREAM(|2714||None|Vigan.04G348700.01), NON_SYNONYMOUS_CODING(MISSENSE|Gct/Tct|A101S|None|Vigan.04G348800.01), UPSTREAM(|967||None|Vigan.04G348900.01)Vigna nepalensis
47071712AG481934.771.00DOWNSTREAM(|3160||None|Vigan.04G348700.01), INTRON(|||None|Vigan.04G348800.01), UPSTREAM(|521||None|Vigan.04G348900.01)Vigna nepalensis
47072371TA411448.771.00DOWNSTREAM(|3819||None|Vigan.04G348700.01), NON_SYNONYMOUS_CODING(MISSENSE|tTc/tAc|F19Y|None|Vigan.04G348900.01), UTR_5_PRIME(|232||None|Vigan.04G348800.01)Vigna nepalensis
47072631GA491910.771.00DOWNSTREAM(|4079||None|Vigan.04G348700.01), NON_SYNONYMOUS_CODING(MISSENSE|aGc/aAc|S78N|None|Vigan.04G348900.01), UTR_5_PRIME(|492||None|Vigan.04G348800.01)Vigna nepalensis

Indels

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
47069830ATATGGATGATA622745.731.00DOWNSTREAM(|1279||None|Vigan.04G348700.01), UPSTREAM(|2402||None|Vigan.04G348900.01), UTR_3_PRIME(|82||None|Vigan.04G348800.01)Vigna nepalensis
47070862TTGATA562572.731.00DOWNSTREAM(|2311||None|Vigan.04G348700.01), INTRON(|||None|Vigan.04G348800.01), UPSTREAM(|1370||None|Vigan.04G348900.01)Vigna nepalensis
47070871GGTCATACTGAAAGAATATT482434.731.00DOWNSTREAM(|2320||None|Vigan.04G348700.01), INTRON(|||None|Vigan.04G348800.01), UPSTREAM(|1361||None|Vigan.04G348900.01)Vigna nepalensis
47072213TGGGTCT371598.731.00DOWNSTREAM(|3662||None|Vigan.04G348700.01), UPSTREAM(|19||None|Vigan.04G348900.01), UTR_5_PRIME(|75||None|Vigan.04G348800.01)Vigna nepalensis
47072448GTG27678.730.96DOWNSTREAM(|3897||None|Vigan.04G348700.01), INTRON(|||None|Vigan.04G348900.01), UTR_5_PRIME(|310||None|Vigan.04G348800.01)Vigna nepalensis