Variant information

Chr04:4134819 - 4140227

Filter



 [SNPs] [Indels]

SNPs

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
4134869AG331236.771.00UPSTREAM(|4099||None|Vigan.04G045700.01), UTR_5_PRIME(|50||None|Vigan.04G045600.01)Vigna nepalensis
4135480AG863256.771.00INTRON(|||None|Vigan.04G045600.01), UPSTREAM(|3488||None|Vigan.04G045700.01)Vigna nepalensis
4135839TC552025.771.00INTRON(|||None|Vigan.04G045600.01), UPSTREAM(|3129||None|Vigan.04G045700.01)Vigna nepalensis
4135867GT562089.771.00INTRON(|||None|Vigan.04G045600.01), UPSTREAM(|3101||None|Vigan.04G045700.01)Vigna nepalensis
4136144AG592328.771.00INTRON(|||None|Vigan.04G045600.01), UPSTREAM(|2824||None|Vigan.04G045700.01)Vigna nepalensis
4136248TC592711.771.00INTRON(|||None|Vigan.04G045600.01), UPSTREAM(|2720||None|Vigan.04G045700.01)Vigna nepalensis
4136293GA532319.771.00INTRON(|||None|Vigan.04G045600.01), UPSTREAM(|2675||None|Vigan.04G045700.01)Vigna nepalensis
4136452CA492017.771.00NON_SYNONYMOUS_CODING(MISSENSE|cCt/cAt|P168H|None|Vigan.04G045600.01), UPSTREAM(|2516||None|Vigan.04G045700.01)Vigna nepalensis
4137279AG582354.771.00DOWNSTREAM(|4972||None|Vigan.04G045800.01), SYNONYMOUS_CODING(SILENT|caA/caG|Q415|None|Vigan.04G045600.01), UPSTREAM(|1689||None|Vigan.04G045700.01)Vigna nepalensis
4137378AG662645.771.00DOWNSTREAM(|4873||None|Vigan.04G045800.01), INTRON(|||None|Vigan.04G045600.01), UPSTREAM(|1590||None|Vigan.04G045700.01)Vigna nepalensis
4137493TG592298.771.00DOWNSTREAM(|4758||None|Vigan.04G045800.01), INTRON(|||None|Vigan.04G045600.01), UPSTREAM(|1475||None|Vigan.04G045700.01)Vigna nepalensis
4137553TG532436.771.00DOWNSTREAM(|4698||None|Vigan.04G045800.01), INTRON(|||None|Vigan.04G045600.01), UPSTREAM(|1415||None|Vigan.04G045700.01), UPSTREAM(|4968||None|Vigan.04G045900.01)Vigna nepalensis
4137554GC542436.771.00DOWNSTREAM(|4697||None|Vigan.04G045800.01), INTRON(|||None|Vigan.04G045600.01), UPSTREAM(|1414||None|Vigan.04G045700.01), UPSTREAM(|4967||None|Vigan.04G045900.01)Vigna nepalensis
4137555AG552436.771.00DOWNSTREAM(|4696||None|Vigan.04G045800.01), INTRON(|||None|Vigan.04G045600.01), UPSTREAM(|1413||None|Vigan.04G045700.01), UPSTREAM(|4966||None|Vigan.04G045900.01)Vigna nepalensis
4137589AG481912.771.00DOWNSTREAM(|4662||None|Vigan.04G045800.01), INTRON(|||None|Vigan.04G045600.01), UPSTREAM(|1379||None|Vigan.04G045700.01), UPSTREAM(|4932||None|Vigan.04G045900.01)Vigna nepalensis
4137774AG542074.771.00DOWNSTREAM(|4477||None|Vigan.04G045800.01), INTRON(|||None|Vigan.04G045600.01), UPSTREAM(|1194||None|Vigan.04G045700.01), UPSTREAM(|4747||None|Vigan.04G045900.01)Vigna nepalensis
4137825CA512094.771.00DOWNSTREAM(|4426||None|Vigan.04G045800.01), INTRON(|||None|Vigan.04G045600.01), UPSTREAM(|1143||None|Vigan.04G045700.01), UPSTREAM(|4696||None|Vigan.04G045900.01)Vigna nepalensis
4137849AT612478.771.00DOWNSTREAM(|4402||None|Vigan.04G045800.01), INTRON(|||None|Vigan.04G045600.01), UPSTREAM(|1119||None|Vigan.04G045700.01), UPSTREAM(|4672||None|Vigan.04G045900.01)Vigna nepalensis
4138007TG552112.771.00DOWNSTREAM(|4244||None|Vigan.04G045800.01), INTRON(|||None|Vigan.04G045600.01), UPSTREAM(|4514||None|Vigan.04G045900.01), UPSTREAM(|961||None|Vigan.04G045700.01)Vigna nepalensis
4138235TC562187.771.00DOWNSTREAM(|4016||None|Vigan.04G045800.01), INTRON(|||None|Vigan.04G045600.01), UPSTREAM(|4286||None|Vigan.04G045900.01), UPSTREAM(|733||None|Vigan.04G045700.01)Vigna nepalensis
4138412TC471814.771.00DOWNSTREAM(|3839||None|Vigan.04G045800.01), INTRON(|||None|Vigan.04G045600.01), UPSTREAM(|4109||None|Vigan.04G045900.01), UPSTREAM(|556||None|Vigan.04G045700.01)Vigna nepalensis
4138465CT401767.771.00DOWNSTREAM(|3786||None|Vigan.04G045800.01), INTRON(|||None|Vigan.04G045600.01), UPSTREAM(|4056||None|Vigan.04G045900.01), UPSTREAM(|503||None|Vigan.04G045700.01)Vigna nepalensis
4138471AC381784.771.00DOWNSTREAM(|3780||None|Vigan.04G045800.01), INTRON(|||None|Vigan.04G045600.01), UPSTREAM(|4050||None|Vigan.04G045900.01), UPSTREAM(|497||None|Vigan.04G045700.01)Vigna nepalensis
4138472GC381720.771.00DOWNSTREAM(|3779||None|Vigan.04G045800.01), INTRON(|||None|Vigan.04G045600.01), UPSTREAM(|4049||None|Vigan.04G045900.01), UPSTREAM(|496||None|Vigan.04G045700.01)Vigna nepalensis
4138732AG381516.771.00DOWNSTREAM(|3519||None|Vigan.04G045800.01), INTRON(|||None|Vigan.04G045600.01), UPSTREAM(|236||None|Vigan.04G045700.01), UPSTREAM(|3789||None|Vigan.04G045900.01)Vigna nepalensis
4138762CA401616.771.00DOWNSTREAM(|3489||None|Vigan.04G045800.01), INTRON(|||None|Vigan.04G045600.01), UPSTREAM(|206||None|Vigan.04G045700.01), UPSTREAM(|3759||None|Vigan.04G045900.01)Vigna nepalensis
4138782CG501967.771.00DOWNSTREAM(|3469||None|Vigan.04G045800.01), INTRON(|||None|Vigan.04G045600.01), UPSTREAM(|186||None|Vigan.04G045700.01), UPSTREAM(|3739||None|Vigan.04G045900.01)Vigna nepalensis
4138876TC471927.771.00DOWNSTREAM(|3375||None|Vigan.04G045800.01), INTRON(|||None|Vigan.04G045600.01), UPSTREAM(|3645||None|Vigan.04G045900.01), UPSTREAM(|92||None|Vigan.04G045700.01)Vigna nepalensis
4138888TC451842.771.00DOWNSTREAM(|3363||None|Vigan.04G045800.01), INTRON(|||None|Vigan.04G045600.01), UPSTREAM(|3633||None|Vigan.04G045900.01), UPSTREAM(|80||None|Vigan.04G045700.01)Vigna nepalensis
4139115AT481891.771.00DOWNSTREAM(|3136||None|Vigan.04G045800.01), INTRON(|||None|Vigan.04G045600.01), INTRON(|||None|Vigan.04G045700.01), UPSTREAM(|3406||None|Vigan.04G045900.01)Vigna nepalensis
4139134TC321304.771.00DOWNSTREAM(|3117||None|Vigan.04G045800.01), INTRON(|||None|Vigan.04G045600.01), INTRON(|||None|Vigan.04G045700.01), UPSTREAM(|3387||None|Vigan.04G045900.01)Vigna nepalensis
4139152AG21883.771.00DOWNSTREAM(|3099||None|Vigan.04G045800.01), INTRON(|||None|Vigan.04G045600.01), INTRON(|||None|Vigan.04G045700.01), UPSTREAM(|3369||None|Vigan.04G045900.01)Vigna nepalensis
4139196AG271208.771.00DOWNSTREAM(|3055||None|Vigan.04G045800.01), INTRON(|||None|Vigan.04G045600.01), INTRON(|||None|Vigan.04G045700.01), UPSTREAM(|3325||None|Vigan.04G045900.01)Vigna nepalensis
4139201AG271159.771.00DOWNSTREAM(|3050||None|Vigan.04G045800.01), INTRON(|||None|Vigan.04G045600.01), INTRON(|||None|Vigan.04G045700.01), UPSTREAM(|3320||None|Vigan.04G045900.01)Vigna nepalensis
4139333AG471743.771.00DOWNSTREAM(|2918||None|Vigan.04G045800.01), INTRON(|||None|Vigan.04G045600.01), INTRON(|||None|Vigan.04G045700.01), UPSTREAM(|3188||None|Vigan.04G045900.01)Vigna nepalensis
4139371AG512054.771.00DOWNSTREAM(|2880||None|Vigan.04G045800.01), INTRON(|||None|Vigan.04G045600.01), INTRON(|||None|Vigan.04G045700.01), UPSTREAM(|3150||None|Vigan.04G045900.01)Vigna nepalensis
4139386GT512078.771.00DOWNSTREAM(|2865||None|Vigan.04G045800.01), INTRON(|||None|Vigan.04G045600.01), INTRON(|||None|Vigan.04G045700.01), UPSTREAM(|3135||None|Vigan.04G045900.01)Vigna nepalensis
4139878GA501961.771.00DOWNSTREAM(|2373||None|Vigan.04G045800.01), DOWNSTREAM(|324||None|Vigan.04G045700.01), UPSTREAM(|2643||None|Vigan.04G045900.01), UTR_3_PRIME(|13||None|Vigan.04G045600.01)Vigna nepalensis

Indels

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
4134836AAAAACGAAAAT341491.731.00UPSTREAM(|4131||None|Vigan.04G045700.01), UTR_5_PRIME(|82||None|Vigan.04G045600.01)Vigna nepalensis
4135597GGT562268.731.00INTRON(|||None|Vigan.04G045600.01), UPSTREAM(|3370||None|Vigan.04G045700.01)Vigna nepalensis
4136198CATTATTATTATTGTTATTATTATTATTC562457.731.00INTRON(|||None|Vigan.04G045600.01), UPSTREAM(|2769||None|Vigan.04G045700.01)Vigna nepalensis
4138678TTAAA351538.731.00DOWNSTREAM(|3572||None|Vigan.04G045800.01), INTRON(|||None|Vigan.04G045600.01), UPSTREAM(|289||None|Vigan.04G045700.01), UPSTREAM(|3842||None|Vigan.04G045900.01)Vigna nepalensis
4138906CTGC441862.731.00DOWNSTREAM(|3344||None|Vigan.04G045800.01), INTRON(|||None|Vigan.04G045600.01), UPSTREAM(|3614||None|Vigan.04G045900.01), UPSTREAM(|61||None|Vigan.04G045700.01)Vigna nepalensis
4138946GGTTGTT441735.731.00DOWNSTREAM(|3304||None|Vigan.04G045800.01), INTRON(|||None|Vigan.04G045600.01), UPSTREAM(|21||None|Vigan.04G045700.01), UPSTREAM(|3574||None|Vigan.04G045900.01)Vigna nepalensis
4139157GGA21869.731.00DOWNSTREAM(|3093||None|Vigan.04G045800.01), INTRON(|||None|Vigan.04G045600.01), INTRON(|||None|Vigan.04G045700.01), UPSTREAM(|3363||None|Vigan.04G045900.01)Vigna nepalensis
4139304GTTG411806.731.00DOWNSTREAM(|2946||None|Vigan.04G045800.01), INTRON(|||None|Vigan.04G045600.01), INTRON(|||None|Vigan.04G045700.01), UPSTREAM(|3216||None|Vigan.04G045900.01)Vigna nepalensis
4139309CCT411806.731.00DOWNSTREAM(|2941||None|Vigan.04G045800.01), INTRON(|||None|Vigan.04G045600.01), INTRON(|||None|Vigan.04G045700.01), UPSTREAM(|3211||None|Vigan.04G045900.01)Vigna nepalensis