Variant information

Chr04:40647211 - 40651693

Filter



 [SNPs] [Indels]

SNPs

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
40647307CG491994.771.00DOWNSTREAM(|209||None|Vigan.04G283300.01), UTR_3_PRIME(|575||None|Vigan.04G283400.01)Vigna nepalensis
40647354GA582316.771.00DOWNSTREAM(|256||None|Vigan.04G283300.01), UTR_3_PRIME(|528||None|Vigan.04G283400.01)Vigna nepalensis
40647636CT642581.771.00DOWNSTREAM(|538||None|Vigan.04G283300.01), UTR_3_PRIME(|246||None|Vigan.04G283400.01)Vigna nepalensis
40647840TC632439.771.00DOWNSTREAM(|742||None|Vigan.04G283300.01), UTR_3_PRIME(|42||None|Vigan.04G283400.01)Vigna nepalensis
40647907TA592333.771.00DOWNSTREAM(|809||None|Vigan.04G283300.01), NON_SYNONYMOUS_CODING(MISSENSE|tAc/tTc|Y135F|None|Vigan.04G283400.01)Vigna nepalensis
40647963TC441780.771.00DOWNSTREAM(|865||None|Vigan.04G283300.01), INTRON(|||None|Vigan.04G283400.01)Vigna nepalensis
40648139AC582332.771.00DOWNSTREAM(|1041||None|Vigan.04G283300.01), INTRON(|||None|Vigan.04G283400.01)Vigna nepalensis
40648172GA522123.771.00DOWNSTREAM(|1074||None|Vigan.04G283300.01), INTRON(|||None|Vigan.04G283400.01)Vigna nepalensis
40648301GA552261.771.00DOWNSTREAM(|1203||None|Vigan.04G283300.01), INTRON(|||None|Vigan.04G283400.01)Vigna nepalensis
40648434TA562345.771.00DOWNSTREAM(|1336||None|Vigan.04G283300.01), INTRON(|||None|Vigan.04G283400.01)Vigna nepalensis
40649101AC472198.771.00DOWNSTREAM(|2003||None|Vigan.04G283300.01), INTRON(|||None|Vigan.04G283400.01)Vigna nepalensis
40649104CA502230.771.00DOWNSTREAM(|2006||None|Vigan.04G283300.01), INTRON(|||None|Vigan.04G283400.01)Vigna nepalensis
40649288GA552120.771.00DOWNSTREAM(|2190||None|Vigan.04G283300.01), INTRON(|||None|Vigan.04G283400.01)Vigna nepalensis
40649394GA532165.771.00DOWNSTREAM(|2296||None|Vigan.04G283300.01), INTRON(|||None|Vigan.04G283400.01)Vigna nepalensis
40649685GC632598.771.00DOWNSTREAM(|2587||None|Vigan.04G283300.01), INTRON(|||None|Vigan.04G283400.01)Vigna nepalensis
40649966AT602475.771.00DOWNSTREAM(|2868||None|Vigan.04G283300.01), INTRON(|||None|Vigan.04G283400.01)Vigna nepalensis
40650034AT491967.771.00DOWNSTREAM(|2936||None|Vigan.04G283300.01), INTRON(|||None|Vigan.04G283400.01)Vigna nepalensis
40650272AG522016.771.00DOWNSTREAM(|3174||None|Vigan.04G283300.01), INTRON(|||None|Vigan.04G283400.01)Vigna nepalensis
40650343AG502017.771.00DOWNSTREAM(|3245||None|Vigan.04G283300.01), INTRON(|||None|Vigan.04G283400.01)Vigna nepalensis
40650374AG451914.771.00DOWNSTREAM(|3276||None|Vigan.04G283300.01), INTRON(|||None|Vigan.04G283400.01)Vigna nepalensis
40650459CT501998.771.00DOWNSTREAM(|3361||None|Vigan.04G283300.01), INTRON(|||None|Vigan.04G283400.01)Vigna nepalensis
40650520GA482207.771.00DOWNSTREAM(|3422||None|Vigan.04G283300.01), INTRON(|||None|Vigan.04G283400.01)Vigna nepalensis
40650534GT522355.771.00DOWNSTREAM(|3436||None|Vigan.04G283300.01), INTRON(|||None|Vigan.04G283400.01)Vigna nepalensis
40650570TC562492.771.00DOWNSTREAM(|3472||None|Vigan.04G283300.01), INTRON(|||None|Vigan.04G283400.01)Vigna nepalensis
40650580AG542526.771.00DOWNSTREAM(|3482||None|Vigan.04G283300.01), INTRON(|||None|Vigan.04G283400.01)Vigna nepalensis
40650638GC491943.771.00DOWNSTREAM(|3540||None|Vigan.04G283300.01), INTRON(|||None|Vigan.04G283400.01)Vigna nepalensis

Indels

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
40648212GAG401183.731.00DOWNSTREAM(|1115||None|Vigan.04G283300.01), INTRON(|||None|Vigan.04G283400.01)Vigna nepalensis
40648802AGGAAACTTTAGTAAACA693020.731.00DOWNSTREAM(|1705||None|Vigan.04G283300.01), INTRON(|||None|Vigan.04G283400.01)Vigna nepalensis
40650386CGC471952.731.00DOWNSTREAM(|3289||None|Vigan.04G283300.01), INTRON(|||None|Vigan.04G283400.01)Vigna nepalensis
40650463GGTATATGATAGCACTTAAATCAATG391700.731.00DOWNSTREAM(|3366||None|Vigan.04G283300.01), INTRON(|||None|Vigan.04G283400.01)Vigna nepalensis
40650535TTA522302.731.00DOWNSTREAM(|3438||None|Vigan.04G283300.01), INTRON(|||None|Vigan.04G283400.01)Vigna nepalensis