Variant information

Chr04:30485601 - 30489251

Filter



 [SNPs] [Indels]

SNPs

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
30485949CT491916.771.00DOWNSTREAM(|3236||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30486048GT682809.771.00DOWNSTREAM(|3335||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30486079AG672802.771.00DOWNSTREAM(|3366||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30486120AT642626.771.00DOWNSTREAM(|3407||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30486179TG572423.771.00DOWNSTREAM(|3466||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30486469GT301321.771.00DOWNSTREAM(|3756||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30486573CT431784.771.00DOWNSTREAM(|3860||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30486618GA642757.771.00DOWNSTREAM(|3905||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30486640CG632832.771.00DOWNSTREAM(|3927||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30486673AG642499.771.00DOWNSTREAM(|3960||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30486943CG441762.771.00DOWNSTREAM(|4230||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30486961TC471911.771.00DOWNSTREAM(|4248||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30487012CA461857.771.00DOWNSTREAM(|4299||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30487037AG411613.771.00DOWNSTREAM(|4324||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30487102CA371660.771.00DOWNSTREAM(|4389||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30487116GA391726.771.00DOWNSTREAM(|4403||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30487137CG391816.771.00DOWNSTREAM(|4424||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30487165AG522311.771.00DOWNSTREAM(|4452||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30487168AG512356.771.00DOWNSTREAM(|4455||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30487184CT502266.771.00DOWNSTREAM(|4471||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30487200AG502311.771.00DOWNSTREAM(|4487||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30487201GA502311.771.00DOWNSTREAM(|4488||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30487206CT492266.771.00DOWNSTREAM(|4493||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30487213TC512356.771.00DOWNSTREAM(|4500||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30487234AG532482.771.00DOWNSTREAM(|4521||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30487246TC512321.771.00DOWNSTREAM(|4533||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30487275TG461998.771.00DOWNSTREAM(|4562||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30487286GA441993.771.00DOWNSTREAM(|4573||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30487288CT431951.771.00DOWNSTREAM(|4575||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30487425AG492159.771.00DOWNSTREAM(|4712||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30487468CT502061.771.00DOWNSTREAM(|4755||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30487647GC552187.771.00DOWNSTREAM(|4934||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30488046AT532077.771.00INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30488903GA441824.771.00UTR_3_PRIME(|147||None|Vigan.04G210100.01)Vigna nepalensis

Indels

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
30485628CACTCTGCATCTGC532335.731.00DOWNSTREAM(|2916||None|Vigan.04G210000.01), UTR_5_PRIME(|55||None|Vigan.04G210100.01)Vigna nepalensis
30486444ATTTATA21907.731.00DOWNSTREAM(|3732||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30486453GGGGGAC21907.731.00DOWNSTREAM(|3741||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30486455AATTACCCACTTATAT201177.731.00DOWNSTREAM(|3743||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30486470AATT301312.731.00DOWNSTREAM(|3758||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30486472AATCTATAAAGTAAAAACCTT291789.731.00DOWNSTREAM(|3760||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30486979AGA451771.731.00DOWNSTREAM(|4267||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30487103CTC381696.731.00DOWNSTREAM(|4391||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30487145CCAAAAGATAT412212.731.00DOWNSTREAM(|4433||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30487174AAG482257.731.00DOWNSTREAM(|4462||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30487336ATA431248.731.00DOWNSTREAM(|4624||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30487411ATA472036.731.00DOWNSTREAM(|4699||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis
30487575TTA591772.731.00DOWNSTREAM(|4863||None|Vigan.04G210000.01), INTRON(|||None|Vigan.04G210100.01)Vigna nepalensis