Variant information

Chr04:15769089 - 15772912

Filter



 [SNPs] [Indels] [SSR-associated indels]

SNPs

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
15769309GA612461.771.00UTR_5_PRIME(|181||None|Vigan.04G132200.01)Vigna nepalensis
15769945CT55207.770.15SYNONYMOUS_CODING(SILENT|gtC/gtT|V152|None|Vigan.04G132200.01)Vigna nepalensis
15769957GC52210.770.17NON_SYNONYMOUS_CODING(MISSENSE|atG/atC|M156I|None|Vigan.04G132200.01)Vigna nepalensis
15769963CT57369.770.21SYNONYMOUS_CODING(SILENT|atC/atT|I158|None|Vigan.04G132200.01)Vigna nepalensis
15769965AG58369.770.22NON_SYNONYMOUS_CODING(MISSENSE|aAg/aGg|K159R|None|Vigan.04G132200.01)Vigna nepalensis
15769994TC62405.770.23SYNONYMOUS_CODING(SILENT|Tta/Cta|L169|None|Vigan.04G132200.01)Vigna nepalensis
15769996AG64486.770.22SYNONYMOUS_CODING(SILENT|ttA/ttG|L169|None|Vigan.04G132200.01)Vigna nepalensis
15769999CT64483.770.25SYNONYMOUS_CODING(SILENT|atC/atT|I170|None|Vigan.04G132200.01)Vigna nepalensis
15770002TC66492.770.24SYNONYMOUS_CODING(SILENT|ttT/ttC|F171|None|Vigan.04G132200.01)Vigna nepalensis
15770017GC56387.770.23SYNONYMOUS_CODING(SILENT|ggG/ggC|G176|None|Vigan.04G132200.01)Vigna nepalensis
15770023CT56387.770.23SYNONYMOUS_CODING(SILENT|ttC/ttT|F178|None|Vigan.04G132200.01)Vigna nepalensis
15770053AT57339.770.21NON_SYNONYMOUS_CODING(MISSENSE|caA/caT|Q188H|None|Vigan.04G132200.01)Vigna nepalensis
15770059TG55336.770.22SYNONYMOUS_CODING(SILENT|ggT/ggG|G190|None|Vigan.04G132200.01)Vigna nepalensis
15770065AT50177.770.14SYNONYMOUS_CODING(SILENT|atA/atT|I192|None|Vigan.04G132200.01)Vigna nepalensis
15770728TG522089.771.00DOWNSTREAM(|4652||None|Vigan.04G132300.01), SYNONYMOUS_CODING(SILENT|acT/acG|T280|None|Vigan.04G132200.01)Vigna nepalensis
15770857GA461853.771.00DOWNSTREAM(|4523||None|Vigan.04G132300.01), INTRON(|||None|Vigan.04G132200.01)Vigna nepalensis
15770915AG511930.771.00DOWNSTREAM(|4465||None|Vigan.04G132300.01), INTRON(|||None|Vigan.04G132200.01)Vigna nepalensis
15770976CT582572.771.00DOWNSTREAM(|4404||None|Vigan.04G132300.01), INTRON(|||None|Vigan.04G132200.01)Vigna nepalensis
15770987CG512335.771.00DOWNSTREAM(|4393||None|Vigan.04G132300.01), INTRON(|||None|Vigan.04G132200.01)Vigna nepalensis
15771076AG502036.771.00DOWNSTREAM(|4304||None|Vigan.04G132300.01), INTRON(|||None|Vigan.04G132200.01)Vigna nepalensis
15771361AC512169.771.00DOWNSTREAM(|4019||None|Vigan.04G132300.01), INTRON(|||None|Vigan.04G132200.01)Vigna nepalensis
15771372CT452079.771.00DOWNSTREAM(|4008||None|Vigan.04G132300.01), INTRON(|||None|Vigan.04G132200.01)Vigna nepalensis
15771442TC482116.771.00DOWNSTREAM(|3938||None|Vigan.04G132300.01), INTRON(|||None|Vigan.04G132200.01)Vigna nepalensis
15771445CT472208.771.00DOWNSTREAM(|3935||None|Vigan.04G132300.01), INTRON(|||None|Vigan.04G132200.01)Vigna nepalensis
15771686TA482211.771.00DOWNSTREAM(|3694||None|Vigan.04G132300.01), INTRON(|||None|Vigan.04G132200.01)Vigna nepalensis
15771864CT482176.771.00DOWNSTREAM(|3516||None|Vigan.04G132300.01), INTRON(|||None|Vigan.04G132200.01)Vigna nepalensis
15771874TC502185.771.00DOWNSTREAM(|3506||None|Vigan.04G132300.01), INTRON(|||None|Vigan.04G132200.01)Vigna nepalensis
15771917GA461877.771.00DOWNSTREAM(|3463||None|Vigan.04G132300.01), INTRON(|||None|Vigan.04G132200.01)Vigna nepalensis
15771978AT502221.771.00DOWNSTREAM(|3402||None|Vigan.04G132300.01), INTRON(|||None|Vigan.04G132200.01)Vigna nepalensis
15771980AT492266.771.00DOWNSTREAM(|3400||None|Vigan.04G132300.01), INTRON(|||None|Vigan.04G132200.01)Vigna nepalensis
15772041CT572596.771.00DOWNSTREAM(|3339||None|Vigan.04G132300.01), INTRON(|||None|Vigan.04G132200.01)Vigna nepalensis
15772052CT592624.771.00DOWNSTREAM(|3328||None|Vigan.04G132300.01), INTRON(|||None|Vigan.04G132200.01)Vigna nepalensis
15772127AC421855.771.00DOWNSTREAM(|3253||None|Vigan.04G132300.01), INTRON(|||None|Vigan.04G132200.01)Vigna nepalensis
15772153TA471914.771.00DOWNSTREAM(|3227||None|Vigan.04G132300.01), INTRON(|||None|Vigan.04G132200.01)Vigna nepalensis
15772315TC552194.771.00DOWNSTREAM(|3065||None|Vigan.04G132300.01), SYNONYMOUS_CODING(SILENT|Ttg/Ctg|L374|None|Vigan.04G132200.01)Vigna nepalensis
15772335GT632458.771.00DOWNSTREAM(|3045||None|Vigan.04G132300.01), SYNONYMOUS_CODING(SILENT|ccG/ccT|P380|None|Vigan.04G132200.01)Vigna nepalensis
15772584TC421604.771.00DOWNSTREAM(|2796||None|Vigan.04G132300.01), SYNONYMOUS_CODING(SILENT|ggT/ggC|G463|None|Vigan.04G132200.01)Vigna nepalensis
15772822AT592315.771.00DOWNSTREAM(|2558||None|Vigan.04G132300.01), UTR_3_PRIME(|166||None|Vigan.04G132200.01)Vigna nepalensis

Indels

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
15769950GCCG55183.730.16FRAME_SHIFT(|ggccga/|GR154|None|Vigan.04G132200.01)Vigna nepalensis
15769954AAGG54198.730.17FRAME_SHIFT(|atg/GGatg|M156G?|None|Vigan.04G132200.01)Vigna nepalensis
15771007ATAGACATA592591.731.00DOWNSTREAM(|4372||None|Vigan.04G132300.01), INTRON(|||None|Vigan.04G132200.01)Vigna nepalensis
15771460AAGCACTTGTTTTCTCCTTCACACCCTTATTTATCATTTAAGAATAGAATATGAGTGTAACTT493399.731.00DOWNSTREAM(|3919||None|Vigan.04G132300.01), INTRON(|||None|Vigan.04G132200.01)Vigna nepalensis
15771713AATCCTTC522434.731.00DOWNSTREAM(|3666||None|Vigan.04G132300.01), INTRON(|||None|Vigan.04G132200.01)Vigna nepalensis
15771717GGTATC502437.731.00DOWNSTREAM(|3662||None|Vigan.04G132300.01), INTRON(|||None|Vigan.04G132200.01)Vigna nepalensis
15771727TTTAC432245.731.00DOWNSTREAM(|3652||None|Vigan.04G132300.01), INTRON(|||None|Vigan.04G132200.01)Vigna nepalensis
15771840ATGATTGAGA532437.731.00DOWNSTREAM(|3539||None|Vigan.04G132300.01), INTRON(|||None|Vigan.04G132200.01)Vigna nepalensis
15771969ATA502174.731.00DOWNSTREAM(|3410||None|Vigan.04G132300.01), INTRON(|||None|Vigan.04G132200.01)Vigna nepalensis
15771989AATATTTTT542662.731.00DOWNSTREAM(|3390||None|Vigan.04G132300.01), INTRON(|||None|Vigan.04G132200.01)Vigna nepalensis
15772005AAT562425.731.00DOWNSTREAM(|3374||None|Vigan.04G132300.01), INTRON(|||None|Vigan.04G132200.01)Vigna nepalensis
15772037TAT552462.731.00DOWNSTREAM(|3342||None|Vigan.04G132300.01), INTRON(|||None|Vigan.04G132200.01)Vigna nepalensis
15772080TTTAAG512249.731.00DOWNSTREAM(|3299||None|Vigan.04G132300.01), INTRON(|||None|Vigan.04G132200.01)Vigna nepalensis
15772106CCG452003.731.00DOWNSTREAM(|3273||None|Vigan.04G132300.01), INTRON(|||None|Vigan.04G132200.01)Vigna nepalensis

SSR-associated indels

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
15771806(AT)17(AT)11592592.731.00DOWNSTREAM(|3573||None|Vigan.04G132300.01), INTRON(|||None|Vigan.04G132200.01)Vigna nepalensis
15771808(AT)17(AT)12592592.731.00DOWNSTREAM(|3571||None|Vigan.04G132300.01), INTRON(|||None|Vigan.04G132200.01)Vigna nepalensis