Variant information

Chr03:38118796 - 38124994

Filter



 [SNPs] [Indels]

SNPs

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
38118860TA552485.771.00DOWNSTREAM(|2454||None|Vigan.03G244900.01), UTR_5_PRIME(|370||None|Vigan.03G245100.01)Vigna nepalensis
38118867AG552468.771.00DOWNSTREAM(|2461||None|Vigan.03G244900.01), UTR_5_PRIME(|363||None|Vigan.03G245100.01)Vigna nepalensis
38118878AC502044.771.00DOWNSTREAM(|2472||None|Vigan.03G244900.01), UTR_5_PRIME(|352||None|Vigan.03G245100.01)Vigna nepalensis
38119280GC381439.771.00DOWNSTREAM(|2874||None|Vigan.03G244900.01), SYNONYMOUS_CODING(SILENT|tcG/tcC|S17|None|Vigan.03G245100.01)Vigna nepalensis
38119861AC431660.771.00DOWNSTREAM(|3455||None|Vigan.03G244900.01), INTRON(|||None|Vigan.03G245100.01)Vigna nepalensis
38119966CT492149.771.00DOWNSTREAM(|3560||None|Vigan.03G244900.01), INTRON(|||None|Vigan.03G245100.01)Vigna nepalensis
38119991CG632767.771.00DOWNSTREAM(|3585||None|Vigan.03G244900.01), INTRON(|||None|Vigan.03G245100.01)Vigna nepalensis
38120125TC652895.771.00DOWNSTREAM(|3719||None|Vigan.03G244900.01), INTRON(|||None|Vigan.03G245100.01)Vigna nepalensis
38120135GT632776.771.00DOWNSTREAM(|3729||None|Vigan.03G244900.01), INTRON(|||None|Vigan.03G245100.01)Vigna nepalensis
38120268CT682764.771.00DOWNSTREAM(|3862||None|Vigan.03G244900.01), INTRON(|||None|Vigan.03G245100.01)Vigna nepalensis
38120476AC662600.771.00DOWNSTREAM(|4070||None|Vigan.03G244900.01), INTRON(|||None|Vigan.03G245100.01)Vigna nepalensis
38120944AG421714.771.00DOWNSTREAM(|4538||None|Vigan.03G244900.01), INTRON(|||None|Vigan.03G245100.01)Vigna nepalensis
38121155TA532097.771.00DOWNSTREAM(|4749||None|Vigan.03G244900.01), INTRON(|||None|Vigan.03G245100.01)Vigna nepalensis
38122467GA572313.771.00INTRON(|||None|Vigan.03G245100.01)Vigna nepalensis
38122651GT642515.771.00INTRON(|||None|Vigan.03G245100.01)Vigna nepalensis
38123928GA512083.771.00INTRON(|||None|Vigan.03G245100.01)Vigna nepalensis
38124077AC592327.771.00INTRON(|||None|Vigan.03G245100.01)Vigna nepalensis
38124436CA622468.771.00SYNONYMOUS_CODING(SILENT|ggC/ggA|G450|None|Vigan.03G245100.01)Vigna nepalensis
38124671CT712950.771.00UTR_3_PRIME(|7||None|Vigan.03G245100.01)Vigna nepalensis

Indels

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
38118890CAAACCAAACCTTCAATCAAC502170.731.00DOWNSTREAM(|2485||None|Vigan.03G244900.01), UTR_5_PRIME(|321||None|Vigan.03G245100.01)Vigna nepalensis
38122009CTAATGAC572528.731.00INTRON(|||None|Vigan.03G245100.01)Vigna nepalensis
38122267ATATTATTCCTTTTTCATCAAACATACAATTCAGTACACTTA261158.731.00INTRON(|||None|Vigan.03G245100.01)Vigna nepalensis
38123030TTA501687.731.00INTRON(|||None|Vigan.03G245100.01)Vigna nepalensis
38124194TAT531648.731.00INTRON(|||None|Vigan.03G245100.01)Vigna nepalensis
38124236TAT572512.731.00INTRON(|||None|Vigan.03G245100.01)Vigna nepalensis
38124252CAC542417.731.00INTRON(|||None|Vigan.03G245100.01)Vigna nepalensis
38124311CCTT542381.731.00INTRON(|||None|Vigan.03G245100.01)Vigna nepalensis
38124903TTCA652887.731.00UTR_3_PRIME(|240||None|Vigan.03G245100.01)Vigna nepalensis