Variant information

Chr03:2272831 - 2276249

Filter



 [SNPs] [Indels]

SNPs

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
2272895CT552205.771.00UTR_5_PRIME(|659||None|Vigan.03G029100.01)Vigna nepalensis
2273150GT421738.771.00UTR_5_PRIME(|404||None|Vigan.03G029100.01)Vigna nepalensis
2273497GA592272.771.00UPSTREAM(|4721||None|Vigan.03G029200.01), UTR_5_PRIME(|57||None|Vigan.03G029100.01)Vigna nepalensis
2273612TC491920.771.00NON_SYNONYMOUS_CODING(MISSENSE|gTt/gCt|V20A|None|Vigan.03G029100.01), UPSTREAM(|4606||None|Vigan.03G029200.01)Vigna nepalensis
2273707CT502264.771.00INTRON(|||None|Vigan.03G029100.01), UPSTREAM(|4511||None|Vigan.03G029200.01)Vigna nepalensis
2273720TC542370.771.00INTRON(|||None|Vigan.03G029100.01), UPSTREAM(|4498||None|Vigan.03G029200.01)Vigna nepalensis
2273955TC421612.771.00INTRON(|||None|Vigan.03G029100.01), UPSTREAM(|4263||None|Vigan.03G029200.01)Vigna nepalensis
2274012GA461784.771.00INTRON(|||None|Vigan.03G029100.01), UPSTREAM(|4206||None|Vigan.03G029200.01)Vigna nepalensis
2274543AG521991.771.00INTRON(|||None|Vigan.03G029100.01), SPLICE_SITE_REGION(|||None|Vigan.03G029100.01), UPSTREAM(|3675||None|Vigan.03G029200.01)Vigna nepalensis
2274573GT491965.771.00SYNONYMOUS_CODING(SILENT|gtG/gtT|V107|None|Vigan.03G029100.01), UPSTREAM(|3645||None|Vigan.03G029200.01)Vigna nepalensis
2274816CA602433.771.00DOWNSTREAM(|4881||None|Vigan.03G029300.01), INTRON(|||None|Vigan.03G029100.01), UPSTREAM(|3402||None|Vigan.03G029200.01)Vigna nepalensis
2275065GA491935.771.00DOWNSTREAM(|4632||None|Vigan.03G029300.01), INTRON(|||None|Vigan.03G029100.01), SPLICE_SITE_REGION(|||None|Vigan.03G029100.01), UPSTREAM(|3153||None|Vigan.03G029200.01)Vigna nepalensis
2275083CA542090.771.00DOWNSTREAM(|4614||None|Vigan.03G029300.01), INTRON(|||None|Vigan.03G029100.01), UPSTREAM(|3135||None|Vigan.03G029200.01)Vigna nepalensis
2275462CG652580.771.00DOWNSTREAM(|4235||None|Vigan.03G029300.01), INTRON(|||None|Vigan.03G029100.01), UPSTREAM(|2756||None|Vigan.03G029200.01)Vigna nepalensis
2275798TC642446.771.00DOWNSTREAM(|3899||None|Vigan.03G029300.01), NON_SYNONYMOUS_CODING(MISSENSE|Tct/Cct|S420P|None|Vigan.03G029100.01), UPSTREAM(|2420||None|Vigan.03G029200.01)Vigna nepalensis

Indels

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
2274121GTG21433.730.95INTRON(|||None|Vigan.03G029100.01), UPSTREAM(|4096||None|Vigan.03G029200.01)Vigna nepalensis
2274480GGTGGTATGATTTATGACTG341496.731.00INTRON(|||None|Vigan.03G029100.01), UPSTREAM(|3737||None|Vigan.03G029200.01)Vigna nepalensis