Variant information

Chr02:4906773 - 4909966

Filter



 [SNPs] [Indels]

SNPs

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
4907308TC491889.771.00DOWNSTREAM(|3139||None|Vigan.02G065600.01), INTRON(|||None|Vigan.02G065500.01)Vigna nepalensis
4907684TC762974.771.00DOWNSTREAM(|2763||None|Vigan.02G065600.01), INTRON(|||None|Vigan.02G065500.01)Vigna nepalensis
4907730CG783074.771.00DOWNSTREAM(|2717||None|Vigan.02G065600.01), INTRON(|||None|Vigan.02G065500.01)Vigna nepalensis
4908081CT622373.771.00DOWNSTREAM(|2366||None|Vigan.02G065600.01), INTRON(|||None|Vigan.02G065500.01)Vigna nepalensis
4908174AC572254.771.00DOWNSTREAM(|2273||None|Vigan.02G065600.01), INTRON(|||None|Vigan.02G065500.01)Vigna nepalensis
4908820CA471961.771.00DOWNSTREAM(|1627||None|Vigan.02G065600.01), DOWNSTREAM(|4440||None|Vigan.02G065700.01), INTRON(|||None|Vigan.02G065500.01)Vigna nepalensis
4908931CT491947.771.00DOWNSTREAM(|1516||None|Vigan.02G065600.01), DOWNSTREAM(|4329||None|Vigan.02G065700.01), INTRON(|||None|Vigan.02G065500.01)Vigna nepalensis
4909126TG391645.771.00DOWNSTREAM(|1321||None|Vigan.02G065600.01), DOWNSTREAM(|4134||None|Vigan.02G065700.01), INTRON(|||None|Vigan.02G065500.01)Vigna nepalensis

Indels

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
4908327CCATCTTGGAAGATATCAAAAGGGTTGGGAATGAAGTGCCAGAAGAAAGAAAAACAAA192569.731.00DOWNSTREAM(|2119||None|Vigan.02G065600.01), DOWNSTREAM(|4932||None|Vigan.02G065700.01), INTRON(|||None|Vigan.02G065500.01)Vigna nepalensis
4908893AAAATGTATTGAAGGTAAGATAATGATGTATTAATAGGATGGTAAT513087.731.00DOWNSTREAM(|1553||None|Vigan.02G065600.01), DOWNSTREAM(|4366||None|Vigan.02G065700.01), INTRON(|||None|Vigan.02G065500.01)Vigna nepalensis