Variant information

Chr02:4689438 - 4698176

Filter



 [SNPs] [Indels]

SNPs

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
4689857AT612335.771.00INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4691950GA552060.771.00INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4692014CA572307.771.00INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4692213CT652583.771.00INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4692852AG411816.771.00INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4692854TC411852.771.00INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4692855CT421852.771.00INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4692898TC371523.771.00INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4692964GC291266.771.00INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4692971CT291263.771.00INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4693019TC271013.771.00INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4693071CT331257.771.00INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4693132CT371360.771.00INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4693159GA391553.771.00INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4693374GA462062.771.00INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4693396GA472060.771.00INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4694238GC712807.771.00INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4694652AG371675.771.00INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4694656CG411788.771.00INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4694737AG371391.771.00INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4694802TC371497.771.00INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4694864GA441693.771.00INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4695036TC401503.771.00INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4695103CT521989.771.00INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4695323GA391475.771.00INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4695379CT511837.770.98INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4695837CG361492.771.00INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4696384GA572458.771.00DOWNSTREAM(|4481||None|Vigan.02G063000.01), INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4696409CT522288.771.00DOWNSTREAM(|4456||None|Vigan.02G063000.01), INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4696460AG652468.771.00DOWNSTREAM(|4405||None|Vigan.02G063000.01), INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4696617TC46144.770.15DOWNSTREAM(|4248||None|Vigan.02G063000.01), INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4696618GA46144.770.15DOWNSTREAM(|4247||None|Vigan.02G063000.01), INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4696699GT441613.530.93DOWNSTREAM(|4166||None|Vigan.02G063000.01), INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4696774TC511561.980.92DOWNSTREAM(|4091||None|Vigan.02G063000.01), INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4696812TG581813.770.81DOWNSTREAM(|4053||None|Vigan.02G063000.01), INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4696842TG622066.770.79DOWNSTREAM(|4023||None|Vigan.02G063000.01), INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4696850GA60229.770.22DOWNSTREAM(|4015||None|Vigan.02G063000.01), INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4696865CT561792.770.79DOWNSTREAM(|4000||None|Vigan.02G063000.01), INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4697464TG531993.771.00DOWNSTREAM(|3401||None|Vigan.02G063000.01), UTR_3_PRIME(|83||None|Vigan.02G062900.01)Vigna nepalensis
4698073GA311135.771.00DOWNSTREAM(|2792||None|Vigan.02G063000.01), UTR_3_PRIME(|692||None|Vigan.02G062900.01)Vigna nepalensis

Indels

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
4691460CTTTTC462002.731.00INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4693447GAAGAGTATCG502181.731.00INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4694547CCTTTCTCCATTCTCTTTCTCCATTCTC7283.751.00INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4695696GCG552164.731.00INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis
4697027AAT461281.731.00DOWNSTREAM(|3837||None|Vigan.02G063000.01), INTRON(|||None|Vigan.02G062900.01)Vigna nepalensis