Variant information

Chr02:34740954 - 34747521

Filter



 [SNPs] [Indels]

SNPs

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
34741169GA441597.771.00SYNONYMOUS_CODING(SILENT|gcG/gcA|A31|None|Vigan.02G247300.01)Vigna nepalensis
34741552GA562239.771.00INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34741710TA562281.771.00INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34741911CT472095.771.00SYNONYMOUS_CODING(SILENT|agC/agT|S100|None|Vigan.02G247300.01)Vigna nepalensis
34741914AG462095.771.00SYNONYMOUS_CODING(SILENT|ggA/ggG|G101|None|Vigan.02G247300.01)Vigna nepalensis
34741949TG461895.771.00INTRON(|||None|Vigan.02G247300.01), SPLICE_SITE_REGION(|||None|Vigan.02G247300.01)Vigna nepalensis
34741993AC602332.771.00INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34742384TA411650.771.00SYNONYMOUS_CODING(SILENT|gcT/gcA|A177|None|Vigan.02G247300.01)Vigna nepalensis
34742489CA552153.771.00INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34742676AG421701.771.00INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34742961GA441852.771.00INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34743056GA642483.771.00SPLICE_SITE_REGION(|||None|Vigan.02G247300.01), SYNONYMOUS_CODING(SILENT|aaG/aaA|K277|None|Vigan.02G247300.01)Vigna nepalensis
34743204TA582292.771.00INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34743359TC582244.771.00INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34743389AT532185.771.00DOWNSTREAM(|4973||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34743402AT542263.771.00DOWNSTREAM(|4960||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34743652AT572155.771.00DOWNSTREAM(|4710||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01), SPLICE_SITE_REGION(|||None|Vigan.02G247300.01)Vigna nepalensis
34743731TC602616.771.00DOWNSTREAM(|4631||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34743776GA502195.771.00DOWNSTREAM(|4586||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34743782GC482146.771.00DOWNSTREAM(|4580||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34743890TC542387.771.00DOWNSTREAM(|4472||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34743891GA532389.771.00DOWNSTREAM(|4471||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34743920GA673166.771.00DOWNSTREAM(|4442||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34743925AG693076.771.00DOWNSTREAM(|4437||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34744365TG673006.771.00DOWNSTREAM(|3997||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34744368AT652969.771.00DOWNSTREAM(|3994||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34744442CT472133.771.00DOWNSTREAM(|3920||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34744451AG472133.771.00DOWNSTREAM(|3911||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34744485TC391816.771.00DOWNSTREAM(|3877||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34744487GC411858.771.00DOWNSTREAM(|3875||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34744496CA411808.771.00DOWNSTREAM(|3866||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34744522CT391644.771.00DOWNSTREAM(|3840||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34744530CA351665.771.00DOWNSTREAM(|3832||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34744538GA391696.771.00DOWNSTREAM(|3824||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34744569AT401639.771.00DOWNSTREAM(|3793||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34744620CA59557.770.29DOWNSTREAM(|3742||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34744622CG59557.770.29DOWNSTREAM(|3740||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34744664GA54717.770.37DOWNSTREAM(|3698||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34744675GT531152.770.57DOWNSTREAM(|3687||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34744676GA521152.770.56DOWNSTREAM(|3686||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34744679TA,
G
222188.771.00DOWNSTREAM(|3683||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34744704GA461177.770.63DOWNSTREAM(|3658||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34744715GA41417.770.32DOWNSTREAM(|3647||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34744721GA411108.770.68DOWNSTREAM(|3641||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34744743GA27202.770.26DOWNSTREAM(|3619||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34744748CT24793.770.83DOWNSTREAM(|3614||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34744757GT2182.770.19DOWNSTREAM(|3605||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34744761AC2188.770.19DOWNSTREAM(|3601||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34744779GC11439.771.00DOWNSTREAM(|3583||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34744790CA9376.781.00DOWNSTREAM(|3572||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34744795GT8331.781.00DOWNSTREAM(|3567||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34745623GC5241.841.00DOWNSTREAM(|2739||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34745627GA6241.841.00DOWNSTREAM(|2735||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34745628TC6241.841.00DOWNSTREAM(|2734||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34745639CT7286.81.00DOWNSTREAM(|2723||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34745650TC9376.781.00DOWNSTREAM(|2712||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34745667CG11425.771.00DOWNSTREAM(|2695||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34745702GT8290.781.00DOWNSTREAM(|2660||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34745713CG6241.841.00DOWNSTREAM(|2649||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34745717AT6241.841.00DOWNSTREAM(|2645||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34745724CT5241.841.00DOWNSTREAM(|2638||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34746081AC682524.770.99DOWNSTREAM(|2281||None|Vigan.02G247400.01), SYNONYMOUS_CODING(SILENT|gtA/gtC|V345|None|Vigan.02G247300.01)Vigna nepalensis
34746213TG732864.771.00DOWNSTREAM(|2149||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34746391AC632749.771.00DOWNSTREAM(|1971||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01), SPLICE_SITE_REGION(|||None|Vigan.02G247300.01)Vigna nepalensis
34746399TA552472.771.00DOWNSTREAM(|1963||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34746425GT471900.771.00DOWNSTREAM(|1937||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34746813TA542372.771.00DOWNSTREAM(|1549||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34746848AG542171.771.00DOWNSTREAM(|1514||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34746912AG622722.771.00DOWNSTREAM(|1450||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34746921CT572614.771.00DOWNSTREAM(|1441||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34746926GT582618.771.00DOWNSTREAM(|1436||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34746973AT632414.771.00DOWNSTREAM(|1389||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34747178TC512291.771.00DOWNSTREAM(|1184||None|Vigan.02G247400.01), UTR_3_PRIME(|71||None|Vigan.02G247300.01)Vigna nepalensis
34747185CG512266.771.00DOWNSTREAM(|1177||None|Vigan.02G247400.01), UTR_3_PRIME(|78||None|Vigan.02G247300.01)Vigna nepalensis
34747360CT491947.771.00DOWNSTREAM(|1002||None|Vigan.02G247400.01), UTR_3_PRIME(|253||None|Vigan.02G247300.01)Vigna nepalensis
34747453CG371464.771.00DOWNSTREAM(|909||None|Vigan.02G247400.01), UTR_3_PRIME(|346||None|Vigan.02G247300.01)Vigna nepalensis
34747498AG391747.771.00DOWNSTREAM(|864||None|Vigan.02G247400.01), UTR_3_PRIME(|391||None|Vigan.02G247300.01)Vigna nepalensis
34747502CG421851.771.00DOWNSTREAM(|860||None|Vigan.02G247400.01), UTR_3_PRIME(|395||None|Vigan.02G247300.01)Vigna nepalensis

Indels

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
34743340TTTGATTCGCCC522699.731.00INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34743748TTG542401.731.00DOWNSTREAM(|4613||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34743955TTGTAGACAAAAATGACTCTGGTAATCGATTACACCATGGCTATAATCGATTACCAGCATGTTTAGTGGGCAAAAACTCCTTGG713230.731.00DOWNSTREAM(|4406||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34744735ACA32223.730.25DOWNSTREAM(|3626||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34744741TTC,
C
71222.731.00DOWNSTREAM(|3620||None|Vigan.02G247400.01), DOWNSTREAM(|3621||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34744783TGT10392.741.00DOWNSTREAM(|3578||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34744787GGC9367.741.00DOWNSTREAM(|3574||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34746164TTTG592616.731.00DOWNSTREAM(|2197||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34746435AACTT371626.731.00DOWNSTREAM(|1926||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34746470GTG391508.731.00DOWNSTREAM(|1891||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis
34746811AGA532363.731.00DOWNSTREAM(|1550||None|Vigan.02G247400.01), INTRON(|||None|Vigan.02G247300.01)Vigna nepalensis