Variant information

Chr01:6530143 - 6536804

Filter



 [SNPs] [Indels]

SNPs

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
6530301GC532148.771.00DOWNSTREAM(|4545||None|Vigan.01G080200.01), NON_SYNONYMOUS_CODING(MISSENSE|cGt/cCt|R4P|None|Vigan.01G080300.01)Vigna nepalensis
6530503TG632534.771.00DOWNSTREAM(|4747||None|Vigan.01G080200.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6530588TA622560.771.00DOWNSTREAM(|4832||None|Vigan.01G080200.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6530735TG532100.771.00DOWNSTREAM(|4979||None|Vigan.01G080200.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6530814TA462015.771.00INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6530829GA431866.771.00INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6530966TC562273.771.00INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6531076GA522099.771.00INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6531120TG632405.770.98INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6531234TC522125.771.00INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6531259CT471885.771.00INTRON(|||None|Vigan.01G080300.01), SPLICE_SITE_REGION(|||None|Vigan.01G080300.01)Vigna nepalensis
6531524AT562247.771.00INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6531669TA431682.771.00INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6531781AG7249.81.00INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6531819GA17770.771.00INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6531842AC23963.771.00INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6532057CT481990.771.00INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6532259AG622485.771.00INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6532285GA602744.771.00INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6532289GA622784.771.00INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6532314GA562337.771.00INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6532326TA552289.771.00INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6532338TC532104.771.00INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6532355GC522145.771.00INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6532375CT492143.771.00INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6532378GA462105.771.00INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6532430AG472086.771.00INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6532431TC472086.771.00INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6532540GA501971.771.00INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6532587TC401570.771.00INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6532705TC451980.771.00INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6532712AT432025.771.00INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6532721CT431951.771.00INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6532724TC421940.771.00INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6532801GA431884.771.00DOWNSTREAM(|4997||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6532819AG452086.771.00DOWNSTREAM(|4979||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6532896GA602675.771.00DOWNSTREAM(|4902||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6532902TC592679.771.00DOWNSTREAM(|4896||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6532928TC562063.771.00DOWNSTREAM(|4870||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6533008AT562207.771.00DOWNSTREAM(|4790||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6533028CT582581.771.00DOWNSTREAM(|4770||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6533030AG582581.771.00DOWNSTREAM(|4768||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6533050TC632839.771.00DOWNSTREAM(|4748||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6533057GA652906.771.00DOWNSTREAM(|4741||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6533083GA632496.771.00DOWNSTREAM(|4715||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6533117CT501990.771.00DOWNSTREAM(|4681||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6533154CA552455.771.00DOWNSTREAM(|4644||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6533164TC542491.771.00DOWNSTREAM(|4634||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6533173CT582655.771.00DOWNSTREAM(|4625||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6533175CT572655.771.00DOWNSTREAM(|4623||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6533294CT512270.771.00DOWNSTREAM(|4504||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6533302TC492258.771.00DOWNSTREAM(|4496||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6533303GA482176.771.00DOWNSTREAM(|4495||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6533467AT542195.771.00DOWNSTREAM(|4331||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6533491CA522113.771.00DOWNSTREAM(|4307||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6533545TC572226.771.00DOWNSTREAM(|4253||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6533561CT562189.771.00DOWNSTREAM(|4237||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6533579GT471860.771.00DOWNSTREAM(|4219||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6533604CT542138.771.00DOWNSTREAM(|4194||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6533623TA501995.771.00DOWNSTREAM(|4175||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6533640TC502008.771.00DOWNSTREAM(|4158||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6533727AT532168.771.00DOWNSTREAM(|4071||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6533867TC431642.771.00DOWNSTREAM(|3931||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6533906GA501868.771.00DOWNSTREAM(|3892||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6534145CT391542.771.00DOWNSTREAM(|3653||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6534194CT522022.771.00DOWNSTREAM(|3604||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6534347CG592369.771.00DOWNSTREAM(|3451||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6534489GA602755.771.00DOWNSTREAM(|3309||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6534500AG572626.771.00DOWNSTREAM(|3298||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6534520GA592709.771.00DOWNSTREAM(|3278||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6534538CT592583.771.00DOWNSTREAM(|3260||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6534592GA692805.771.00DOWNSTREAM(|3206||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6534655CT733191.821.00DOWNSTREAM(|3143||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6534664TC662908.771.00DOWNSTREAM(|3134||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6534707AG702710.770.99DOWNSTREAM(|3091||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6534807CT612221.770.98DOWNSTREAM(|2991||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6534949GT572502.771.00DOWNSTREAM(|2849||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6534992AG702824.771.00DOWNSTREAM(|2806||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6535721GA723185.771.00DOWNSTREAM(|2077||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6535732AT642966.771.00DOWNSTREAM(|2066||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6535740CG632844.771.00DOWNSTREAM(|2058||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6535976TA693118.771.00DOWNSTREAM(|1822||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6536004TA632488.771.00DOWNSTREAM(|1794||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6536435GA532067.771.00DOWNSTREAM(|1363||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6536575AT532385.771.00DOWNSTREAM(|1223||None|Vigan.01G080400.01), UTR_3_PRIME(|1||None|Vigan.01G080300.01)Vigna nepalensis
6536579AT532420.771.00DOWNSTREAM(|1219||None|Vigan.01G080400.01), UTR_3_PRIME(|5||None|Vigan.01G080300.01)Vigna nepalensis
6536702AG693093.771.00DOWNSTREAM(|1096||None|Vigan.01G080400.01), UTR_3_PRIME(|128||None|Vigan.01G080300.01)Vigna nepalensis
6536703AG693093.771.00DOWNSTREAM(|1095||None|Vigan.01G080400.01), UTR_3_PRIME(|129||None|Vigan.01G080300.01)Vigna nepalensis
6536720GT692633.771.00DOWNSTREAM(|1078||None|Vigan.01G080400.01), UTR_3_PRIME(|146||None|Vigan.01G080300.01)Vigna nepalensis

Indels

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
6530644CAC501967.731.00DOWNSTREAM(|4889||None|Vigan.01G080200.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6531702CCG331111.731.00INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6531823GAG18761.731.00INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6531867CTC311069.731.00INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6532017AAAC502269.731.00INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6532445GAG491794.731.00INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6532828CTGCGATC441978.731.00DOWNSTREAM(|4969||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6533277CAC461280.731.00DOWNSTREAM(|4520||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6534241CCAT582581.731.00DOWNSTREAM(|3556||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6534447AAAGAGACT542644.731.00DOWNSTREAM(|3350||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6534467CTTC512309.731.00DOWNSTREAM(|3330||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6534905TGT592547.731.00DOWNSTREAM(|2892||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6534907AAAGTATTAGAAAATTCAAGTGA592546.731.00DOWNSTREAM(|2890||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6535734ATGA642932.731.00DOWNSTREAM(|2063||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6535800AATTA652913.731.00DOWNSTREAM(|1997||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6535805TTAAA663003.731.00DOWNSTREAM(|1992||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6535866GAG571738.731.00DOWNSTREAM(|1931||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6535944CTATTTC652925.731.00DOWNSTREAM(|1853||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6535963TTA753371.731.00DOWNSTREAM(|1834||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis
6536520TTTC512229.731.00DOWNSTREAM(|1277||None|Vigan.01G080400.01), INTRON(|||None|Vigan.01G080300.01)Vigna nepalensis