Variant information

Chr01:6336808 - 6339439

Filter



 [SNPs] [Indels]

SNPs

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
6338123AT592382.771.00DOWNSTREAM(|3876||None|Vigan.01G078400.01), INTRON(|||None|Vigan.01G078500.01)Vigna nepalensis
6338406CG532016.771.00DOWNSTREAM(|4159||None|Vigan.01G078400.01), INTRON(|||None|Vigan.01G078500.01)Vigna nepalensis
6339364GA461727.771.00UTR_5_PRIME(|109||None|Vigan.01G078500.01)Vigna nepalensis

Indels

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
6338177TAT602390.731.00DOWNSTREAM(|3931||None|Vigan.01G078400.01), INTRON(|||None|Vigan.01G078500.01)Vigna nepalensis
6338527CAC552018.731.00DOWNSTREAM(|4281||None|Vigan.01G078400.01), INTRON(|||None|Vigan.01G078500.01)Vigna nepalensis
6338576TTAAAACCAGTCGGGTGGAAGAAAAACTAAA392237.731.00DOWNSTREAM(|4330||None|Vigan.01G078400.01), INTRON(|||None|Vigan.01G078500.01)Vigna nepalensis
6339055GAG331019.731.00DOWNSTREAM(|4809||None|Vigan.01G078400.01), INTRON(|||None|Vigan.01G078500.01)Vigna nepalensis