Variant information

Chr01:59125219 - 59127241

Filter



 [SNPs] [Indels]

SNPs

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
59125268CG341300.771.00DOWNSTREAM(|4537||None|Vigan.01G461700.01), DOWNSTREAM(|4563||None|Vigan.01G461900.01), UTR_5_PRIME(|340||None|Vigan.01G461800.01)Vigna nepalensis
59125344GA502053.771.00DOWNSTREAM(|4487||None|Vigan.01G461900.01), DOWNSTREAM(|4613||None|Vigan.01G461700.01), UTR_5_PRIME(|264||None|Vigan.01G461800.01)Vigna nepalensis
59125705GA561916.771.00DOWNSTREAM(|4126||None|Vigan.01G461900.01), DOWNSTREAM(|4974||None|Vigan.01G461700.01), INTRON(|||None|Vigan.01G461800.01)Vigna nepalensis
59125852TC632473.771.00DOWNSTREAM(|3979||None|Vigan.01G461900.01), INTRON(|||None|Vigan.01G461800.01)Vigna nepalensis
59126280GT612506.771.00DOWNSTREAM(|3551||None|Vigan.01G461900.01), INTRON(|||None|Vigan.01G461800.01)Vigna nepalensis

Indels

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
59125689TTTCT481321.731.00DOWNSTREAM(|4141||None|Vigan.01G461900.01), DOWNSTREAM(|4959||None|Vigan.01G461700.01), INTRON(|||None|Vigan.01G461800.01)Vigna nepalensis
59126077ATA501463.731.00DOWNSTREAM(|3753||None|Vigan.01G461900.01), INTRON(|||None|Vigan.01G461800.01)Vigna nepalensis
59126477CTTC542028.731.00DOWNSTREAM(|3353||None|Vigan.01G461900.01), INTRON(|||None|Vigan.01G461800.01)Vigna nepalensis
59127047CTC521523.731.00DOWNSTREAM(|2783||None|Vigan.01G461900.01), UPSTREAM(|4910||None|Vigan.01G462000.01), UTR_3_PRIME(|84||None|Vigan.01G461800.01)Vigna nepalensis
59127229GAATGCAATTATGTCATGCCACTAGAGGTCTCGTTGCTAAAACATATTTTTGTAAATGTAGTTATAGTG622725.731.00DOWNSTREAM(|0||None|Vigan.01G461800.01), DOWNSTREAM(|2601||None|Vigan.01G461900.01), INTERGENIC(||||), INTRAGENIC(|||None|), UPSTREAM(|4728||None|Vigan.01G462000.01), UTR_3_PRIME(|266||None|Vigan.01G461800.01)Vigna nepalensis