Variant information

Chr01:58387204 - 58389139

Filter



 [SNPs] [Indels]

SNPs

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
58387593AT542045.771.00DOWNSTREAM(|3445||None|Vigan.01G452900.01), INTRON(|||None|Vigan.01G453000.01)Vigna nepalensis
58387873CT411848.771.00DOWNSTREAM(|3725||None|Vigan.01G452900.01), INTRON(|||None|Vigan.01G453000.01)Vigna nepalensis
58388227CT542081.771.00DOWNSTREAM(|4079||None|Vigan.01G452900.01), INTRON(|||None|Vigan.01G453000.01)Vigna nepalensis
58388327GA582581.771.00DOWNSTREAM(|4179||None|Vigan.01G452900.01), INTRON(|||None|Vigan.01G453000.01)Vigna nepalensis
58388337TG562502.771.00DOWNSTREAM(|4189||None|Vigan.01G452900.01), INTRON(|||None|Vigan.01G453000.01)Vigna nepalensis
58388542CT612392.771.00DOWNSTREAM(|4394||None|Vigan.01G452900.01), INTRON(|||None|Vigan.01G453000.01)Vigna nepalensis
58388574GA532172.771.00DOWNSTREAM(|4426||None|Vigan.01G452900.01), INTRON(|||None|Vigan.01G453000.01)Vigna nepalensis
58389057AT512027.771.00DOWNSTREAM(|4909||None|Vigan.01G452900.01), UTR_3_PRIME(|252||None|Vigan.01G453000.01)Vigna nepalensis
58389090AT552423.771.00DOWNSTREAM(|4942||None|Vigan.01G452900.01), UTR_3_PRIME(|285||None|Vigan.01G453000.01)Vigna nepalensis
58389096AT542380.771.00DOWNSTREAM(|4948||None|Vigan.01G452900.01), UTR_3_PRIME(|291||None|Vigan.01G453000.01)Vigna nepalensis

Indels

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
58387218GGA521631.731.00DOWNSTREAM(|3071||None|Vigan.01G452900.01), UTR_5_PRIME(|75||None|Vigan.01G453000.01)Vigna nepalensis
58387775GATTTTATACCTTGTGGTGTTGGATCAGTTGTACCTGTCATTTGGTGGGAATGCTATATGGAGGTGGTTCAATTCTG482325.731.00DOWNSTREAM(|3628||None|Vigan.01G452900.01), INTRON(|||None|Vigan.01G453000.01)Vigna nepalensis
58388131GGAAAG522286.731.00DOWNSTREAM(|3984||None|Vigan.01G452900.01), INTRON(|||None|Vigan.01G453000.01)Vigna nepalensis