Variant information

Chr01:5719550 - 5722358

Filter



 [SNPs] [Indels]

SNPs

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
5719943GC281129.771.00DOWNSTREAM(|4005||None|Vigan.01G071600.01), NON_SYNONYMOUS_CODING(MISSENSE|tgG/tgC|W6C|None|Vigan.01G071700.01), UPSTREAM(|3483||None|Vigan.01G071800.01)Vigna nepalensis
5720778AT572152.771.00DOWNSTREAM(|4840||None|Vigan.01G071600.01), INTRON(|||None|Vigan.01G071700.01), UPSTREAM(|2648||None|Vigan.01G071800.01)Vigna nepalensis
5720969CT622367.771.00INTRON(|||None|Vigan.01G071700.01), UPSTREAM(|2457||None|Vigan.01G071800.01)Vigna nepalensis
5721156AT692704.771.00INTRON(|||None|Vigan.01G071700.01), UPSTREAM(|2270||None|Vigan.01G071800.01)Vigna nepalensis
5721468TG562310.771.00INTRON(|||None|Vigan.01G071700.01), UPSTREAM(|1958||None|Vigan.01G071800.01)Vigna nepalensis

Indels

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
5721670ACTA582432.731.00INTRON(|||None|Vigan.01G071700.01), UPSTREAM(|1755||None|Vigan.01G071800.01)Vigna nepalensis
5722246GAG532251.731.00UPSTREAM(|1179||None|Vigan.01G071800.01), UTR_3_PRIME(|131||None|Vigan.01G071700.01)Vigna nepalensis
5722248CAACAATTTTGCGGATGTTAAGTTGCTGTTGAAAAGTGTTTACGCTTATCTTCATTTGAC532248.731.00UPSTREAM(|1177||None|Vigan.01G071800.01), UTR_3_PRIME(|133||None|Vigan.01G071700.01)Vigna nepalensis