Variant information

Chr01:40687636 - 40689298

Filter



 [SNPs] [Indels]

SNPs

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
40687822GA762898.771.00DOWNSTREAM(|1674||None|Vigan.01G286000.01), DOWNSTREAM(|3490||None|Vigan.01G286200.01), NON_SYNONYMOUS_CODING(MISSENSE|Gtt/Att|V45I|None|Vigan.01G286100.01), UPSTREAM(|3767||None|Vigan.01G286300.01)Vigna nepalensis
40688498TC742654.771.00DOWNSTREAM(|2350||None|Vigan.01G286000.01), DOWNSTREAM(|2814||None|Vigan.01G286200.01), SYNONYMOUS_CODING(SILENT|caT/caC|H221|None|Vigan.01G286100.01), UPSTREAM(|3091||None|Vigan.01G286300.01)Vigna nepalensis
40688662CA602285.771.00DOWNSTREAM(|2514||None|Vigan.01G286000.01), DOWNSTREAM(|2650||None|Vigan.01G286200.01), INTRON(|||None|Vigan.01G286100.01), UPSTREAM(|2927||None|Vigan.01G286300.01)Vigna nepalensis
40689127CA602405.771.00DOWNSTREAM(|2185||None|Vigan.01G286200.01), DOWNSTREAM(|2979||None|Vigan.01G286000.01), UPSTREAM(|2462||None|Vigan.01G286300.01), UTR_3_PRIME(|115||None|Vigan.01G286100.01)Vigna nepalensis
40689141AT522163.771.00DOWNSTREAM(|2171||None|Vigan.01G286200.01), DOWNSTREAM(|2993||None|Vigan.01G286000.01), UPSTREAM(|2448||None|Vigan.01G286300.01), UTR_3_PRIME(|129||None|Vigan.01G286100.01)Vigna nepalensis
40689196GT17723.771.00DOWNSTREAM(|2116||None|Vigan.01G286200.01), DOWNSTREAM(|3048||None|Vigan.01G286000.01), UPSTREAM(|2393||None|Vigan.01G286300.01), UTR_3_PRIME(|184||None|Vigan.01G286100.01)Vigna nepalensis

Indels

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
40689163CTC391352.731.00DOWNSTREAM(|2148||None|Vigan.01G286200.01), DOWNSTREAM(|3016||None|Vigan.01G286000.01), UPSTREAM(|2425||None|Vigan.01G286300.01), UTR_3_PRIME(|152||None|Vigan.01G286100.01)Vigna nepalensis
40689198TTATATTTTTAATTCTTTCCCTGTATAATCTTTTGA16715.731.00DOWNSTREAM(|2113||None|Vigan.01G286200.01), DOWNSTREAM(|3051||None|Vigan.01G286000.01), UPSTREAM(|2390||None|Vigan.01G286300.01), UTR_3_PRIME(|187||None|Vigan.01G286100.01)Vigna nepalensis