Variant information

Chr01:32622964 - 32626619

Filter



 [SNPs] [Indels]

SNPs

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
32623003GA562436.771.00DOWNSTREAM(|3076||None|Vigan.01G239600.01), UTR_5_PRIME(|88||None|Vigan.01G239700.01)Vigna nepalensis
32623006AC542436.771.00DOWNSTREAM(|3079||None|Vigan.01G239600.01), UTR_5_PRIME(|85||None|Vigan.01G239700.01)Vigna nepalensis
32623041GA472104.771.00DOWNSTREAM(|3114||None|Vigan.01G239600.01), UTR_5_PRIME(|50||None|Vigan.01G239700.01)Vigna nepalensis
32623056CT502266.771.00DOWNSTREAM(|3129||None|Vigan.01G239600.01), UTR_5_PRIME(|35||None|Vigan.01G239700.01)Vigna nepalensis
32623057AG492435.771.00DOWNSTREAM(|3130||None|Vigan.01G239600.01), UTR_5_PRIME(|34||None|Vigan.01G239700.01)Vigna nepalensis
32623078CT502156.771.00DOWNSTREAM(|3151||None|Vigan.01G239600.01), UTR_5_PRIME(|13||None|Vigan.01G239700.01)Vigna nepalensis
32623191CT482024.771.00DOWNSTREAM(|3264||None|Vigan.01G239600.01), INTRON(|||None|Vigan.01G239700.01)Vigna nepalensis
32623353CA512350.771.00DOWNSTREAM(|3426||None|Vigan.01G239600.01), INTRON(|||None|Vigan.01G239700.01)Vigna nepalensis
32623356CG532391.771.00DOWNSTREAM(|3429||None|Vigan.01G239600.01), INTRON(|||None|Vigan.01G239700.01)Vigna nepalensis
32623358CT532391.771.00DOWNSTREAM(|3431||None|Vigan.01G239600.01), INTRON(|||None|Vigan.01G239700.01)Vigna nepalensis
32623450AT582201.771.00DOWNSTREAM(|3523||None|Vigan.01G239600.01), INTRON(|||None|Vigan.01G239700.01)Vigna nepalensis
32623634TG612274.771.00DOWNSTREAM(|3707||None|Vigan.01G239600.01), INTRON(|||None|Vigan.01G239700.01)Vigna nepalensis
32623920CT642440.771.00DOWNSTREAM(|3993||None|Vigan.01G239600.01), INTRON(|||None|Vigan.01G239700.01)Vigna nepalensis
32624099CG562519.771.00DOWNSTREAM(|4172||None|Vigan.01G239600.01), INTRON(|||None|Vigan.01G239700.01)Vigna nepalensis
32624112TC522334.771.00DOWNSTREAM(|4185||None|Vigan.01G239600.01), INTRON(|||None|Vigan.01G239700.01)Vigna nepalensis
32624220CT462002.771.00DOWNSTREAM(|4293||None|Vigan.01G239600.01), INTRON(|||None|Vigan.01G239700.01)Vigna nepalensis
32624313AT592409.771.00DOWNSTREAM(|4386||None|Vigan.01G239600.01), INTRON(|||None|Vigan.01G239700.01)Vigna nepalensis
32625142TC632625.771.00INTRON(|||None|Vigan.01G239700.01)Vigna nepalensis
32625221CA592327.771.00INTRON(|||None|Vigan.01G239700.01)Vigna nepalensis
32625241AG622770.771.00INTRON(|||None|Vigan.01G239700.01)Vigna nepalensis
32625245AT602713.771.00INTRON(|||None|Vigan.01G239700.01)Vigna nepalensis
32625246CA602713.771.00INTRON(|||None|Vigan.01G239700.01)Vigna nepalensis
32625329TC351447.771.00INTRON(|||None|Vigan.01G239700.01)Vigna nepalensis
32625373GC401590.771.00INTRON(|||None|Vigan.01G239700.01)Vigna nepalensis
32625387TC471780.771.00INTRON(|||None|Vigan.01G239700.01)Vigna nepalensis

Indels

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
32623732TGGT672969.731.00DOWNSTREAM(|3806||None|Vigan.01G239600.01), INTRON(|||None|Vigan.01G239700.01)Vigna nepalensis
32623749GTTG602713.731.00DOWNSTREAM(|3823||None|Vigan.01G239600.01), INTRON(|||None|Vigan.01G239700.01)Vigna nepalensis
32623756AAT602842.731.00DOWNSTREAM(|3830||None|Vigan.01G239600.01), INTRON(|||None|Vigan.01G239700.01)Vigna nepalensis
32623758TCCCCCTTGATTAAAATAACTTATGAAATCATAAACCTATAGCAAACATGTTAGGCAT632797.731.00DOWNSTREAM(|3832||None|Vigan.01G239600.01), INTRON(|||None|Vigan.01G239700.01)Vigna nepalensis
32623817TACTCATCTGACTTGGCTTGGCTTTGAGACGT612759.731.00DOWNSTREAM(|3891||None|Vigan.01G239600.01), INTRON(|||None|Vigan.01G239700.01)Vigna nepalensis
32624090CCT512284.731.00DOWNSTREAM(|4164||None|Vigan.01G239600.01), INTRON(|||None|Vigan.01G239700.01)Vigna nepalensis
32624175TCTACACACATAACACATCCATAAATGGTACT421854.731.00DOWNSTREAM(|4249||None|Vigan.01G239600.01), INTRON(|||None|Vigan.01G239700.01)Vigna nepalensis
32624723TGTAGT683002.731.00DOWNSTREAM(|4797||None|Vigan.01G239600.01), INTRON(|||None|Vigan.01G239700.01)Vigna nepalensis
32625296TTGAT451971.731.00INTRON(|||None|Vigan.01G239700.01)Vigna nepalensis