Variant information

Chr01:20350958 - 20356537

Filter



 [SNPs] [Indels]

SNPs

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
20350961AT512232.771.00UTR_5_PRIME(|396||None|Vigan.01G175300.01)Vigna nepalensis
20350982GC592522.771.00UTR_5_PRIME(|375||None|Vigan.01G175300.01)Vigna nepalensis
20351254TC562194.771.00UTR_5_PRIME(|103||None|Vigan.01G175300.01)Vigna nepalensis
20351308CA491940.771.00UTR_5_PRIME(|49||None|Vigan.01G175300.01)Vigna nepalensis
20351536AG421665.771.00INTRON(|||None|Vigan.01G175300.01)Vigna nepalensis
20351650GT491914.771.00INTRON(|||None|Vigan.01G175300.01)Vigna nepalensis
20351786GA511929.771.00SYNONYMOUS_CODING(SILENT|ggG/ggA|G64|None|Vigan.01G175300.01)Vigna nepalensis
20352181GA512092.771.00INTRON(|||None|Vigan.01G175300.01)Vigna nepalensis
20352532CT331350.771.00INTRON(|||None|Vigan.01G175300.01)Vigna nepalensis
20352777GT582278.771.00DOWNSTREAM(|4817||None|Vigan.01G175400.01), INTRON(|||None|Vigan.01G175300.01)Vigna nepalensis
20352827AT602225.771.00DOWNSTREAM(|4767||None|Vigan.01G175400.01), INTRON(|||None|Vigan.01G175300.01)Vigna nepalensis
20353062TC441646.771.00DOWNSTREAM(|4532||None|Vigan.01G175400.01), INTRON(|||None|Vigan.01G175300.01)Vigna nepalensis
20353134GT301152.771.00DOWNSTREAM(|4460||None|Vigan.01G175400.01), INTRON(|||None|Vigan.01G175300.01)Vigna nepalensis
20353238TC381597.771.00DOWNSTREAM(|4356||None|Vigan.01G175400.01), INTRON(|||None|Vigan.01G175300.01)Vigna nepalensis
20354097GA622359.771.00DOWNSTREAM(|3497||None|Vigan.01G175400.01), INTRON(|||None|Vigan.01G175300.01)Vigna nepalensis
20354334CG532040.771.00DOWNSTREAM(|3260||None|Vigan.01G175400.01), INTRON(|||None|Vigan.01G175300.01)Vigna nepalensis
20354393TC632551.771.00DOWNSTREAM(|3201||None|Vigan.01G175400.01), INTRON(|||None|Vigan.01G175300.01)Vigna nepalensis
20354525GA512061.771.00DOWNSTREAM(|3069||None|Vigan.01G175400.01), INTRON(|||None|Vigan.01G175300.01)Vigna nepalensis
20354694CT431652.771.00DOWNSTREAM(|2900||None|Vigan.01G175400.01), INTRON(|||None|Vigan.01G175300.01)Vigna nepalensis
20354760CA391554.771.00DOWNSTREAM(|2834||None|Vigan.01G175400.01), INTRON(|||None|Vigan.01G175300.01)Vigna nepalensis
20354851GA582315.771.00DOWNSTREAM(|2743||None|Vigan.01G175400.01), INTRON(|||None|Vigan.01G175300.01)Vigna nepalensis
20354992AT451847.771.00DOWNSTREAM(|2602||None|Vigan.01G175400.01), INTRON(|||None|Vigan.01G175300.01)Vigna nepalensis
20355640TG582375.771.00DOWNSTREAM(|1954||None|Vigan.01G175400.01), INTRON(|||None|Vigan.01G175300.01)Vigna nepalensis
20355759TC461940.771.00DOWNSTREAM(|1835||None|Vigan.01G175400.01), INTRON(|||None|Vigan.01G175300.01)Vigna nepalensis
20355832GA531985.771.00DOWNSTREAM(|1762||None|Vigan.01G175400.01), INTRON(|||None|Vigan.01G175300.01)Vigna nepalensis
20356048AC572258.771.00DOWNSTREAM(|1546||None|Vigan.01G175400.01), INTRON(|||None|Vigan.01G175300.01)Vigna nepalensis

Indels

PositionRef.Alt.DepthScoreFreq. Of Alt.EffectSpecies
20351009CCACACTGATTACCTAGTTGCGAT482738.731.00UTR_5_PRIME(|347||None|Vigan.01G175300.01)Vigna nepalensis
20351052TAT441723.731.00UTR_5_PRIME(|304||None|Vigan.01G175300.01)Vigna nepalensis
20352761TGT551720.731.00DOWNSTREAM(|4832||None|Vigan.01G175400.01), INTRON(|||None|Vigan.01G175300.01)Vigna nepalensis
20352970AAT501979.731.00DOWNSTREAM(|4623||None|Vigan.01G175400.01), INTRON(|||None|Vigan.01G175300.01)Vigna nepalensis